Incidental Mutation 'R6918:Ddc'
ID539452
Institutional Source Beutler Lab
Gene Symbol Ddc
Ensembl Gene ENSMUSG00000020182
Gene Namedopa decarboxylase
SynonymsAadc, aromatic L-amino acid decarboxylase
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6918 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location11814101-11898144 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 11819307 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 409 (V409A)
Ref Sequence ENSEMBL: ENSMUSP00000136467 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066237] [ENSMUST00000109659] [ENSMUST00000178704]
Predicted Effect probably damaging
Transcript: ENSMUST00000066237
AA Change: V409A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000068525
Gene: ENSMUSG00000020182
AA Change: V409A

DomainStartEndE-ValueType
Pfam:Pyridoxal_deC 35 414 8.2e-173 PFAM
Pfam:Beta_elim_lyase 81 401 2.3e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109659
AA Change: V409A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105286
Gene: ENSMUSG00000020182
AA Change: V409A

DomainStartEndE-ValueType
Pfam:Pyridoxal_deC 35 414 4.8e-174 PFAM
Pfam:Beta_elim_lyase 82 403 4.4e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000178704
AA Change: V409A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136467
Gene: ENSMUSG00000020182
AA Change: V409A

DomainStartEndE-ValueType
Pfam:Pyridoxal_deC 35 414 8.2e-173 PFAM
Pfam:Beta_elim_lyase 81 401 2.3e-9 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The encoded protein catalyzes the decarboxylation of L-3,4-dihydroxyphenylalanine (DOPA) to dopamine, L-5-hydroxytryptophan to serotonin and L-tryptophan to tryptamine. Defects in this gene are the cause of aromatic L-amino-acid decarboxylase deficiency (AADCD). AADCD deficiency is an inborn error in neurotransmitter metabolism that leads to combined serotonin and catecholamine deficiency. Multiple alternatively spliced transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Jun 2011]
PHENOTYPE: Mice homozygous for one knock-out allele exhibit preweaning phenotype. Mice homozygous for a different knock-in allele exhibit partial prenatal lethality, decreased body size, postnatal growth retardation, hypoactivity, increased anxiety, tremors, decreased heart rate and decreased dopamine levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210011C24Rik T G 8: 84,011,684 M1L probably benign Het
Abca3 A C 17: 24,408,658 K1359Q probably damaging Het
Ace T C 11: 105,972,943 Y406H probably damaging Het
Acsl6 A G 11: 54,341,756 probably null Het
Alms1 T A 6: 85,622,661 Y1959N possibly damaging Het
BC037034 A G 5: 138,260,664 V211A probably benign Het
Chrna7 T A 7: 63,159,551 I76F probably benign Het
Cuedc1 C T 11: 88,187,073 T296I probably benign Het
Dhx8 T A 11: 101,738,421 Y212* probably null Het
Dnah6 T A 6: 73,181,755 K622* probably null Het
Dscaml1 A G 9: 45,430,507 H72R probably benign Het
Dyrk1b A G 7: 28,185,925 D396G probably damaging Het
Gstm2 A G 3: 107,985,241 probably null Het
Hsd3b1 A G 3: 98,853,109 Y189H probably damaging Het
Kif1c G A 11: 70,706,987 E356K probably damaging Het
Kirrel2 A C 7: 30,450,814 C17G probably damaging Het
Klhl12 A G 1: 134,475,846 H259R possibly damaging Het
Krt1 A G 15: 101,850,177 V184A probably damaging Het
Lmod2 A T 6: 24,603,595 N190Y probably benign Het
Lrp2 A C 2: 69,489,305 V1958G probably damaging Het
Ly6h T C 15: 75,565,658 S37G probably damaging Het
Man2a2 A T 7: 80,353,192 H1056Q possibly damaging Het
Mixl1 T A 1: 180,694,678 I213F probably benign Het
Morc3 T C 16: 93,853,135 I268T probably benign Het
Mtx2 C T 2: 74,876,353 T224I probably damaging Het
Olfr893 G A 9: 38,209,652 V198M possibly damaging Het
Oscp1 A C 4: 126,076,778 D120A possibly damaging Het
Parp1 G A 1: 180,588,670 V545I possibly damaging Het
Pipox A G 11: 77,881,554 I330T probably damaging Het
Pkp2 A G 16: 16,272,218 Y790C probably damaging Het
Pomt1 T A 2: 32,252,861 probably null Het
Pp2d1 G A 17: 53,515,459 T193M probably damaging Het
Prkra G T 2: 76,630,453 H300Q probably damaging Het
Ror2 T G 13: 53,111,451 N523T probably damaging Het
Rp1 A T 1: 3,999,608 D1355E unknown Het
Rsph4a T C 10: 33,905,276 Y41H probably benign Het
Scn1a T A 2: 66,332,213 I230F probably damaging Het
Taar7e T A 10: 24,037,615 M1K probably null Het
Tex15 T G 8: 33,573,184 L1155V probably benign Het
Tmprss3 T C 17: 31,188,357 K321E probably benign Het
Tsc2 A T 17: 24,613,229 C728S probably damaging Het
Ube2e3 A T 2: 78,920,039 K203M probably damaging Het
Unc50 A T 1: 37,438,702 T222S probably damaging Het
Vmn1r236 A T 17: 21,287,616 H332L probably benign Het
Vmn2r7 G A 3: 64,691,339 T599I probably benign Het
Zfp334 A T 2: 165,381,879 D81E possibly damaging Het
Zfp710 A G 7: 80,082,040 I322V possibly damaging Het
Other mutations in Ddc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01307:Ddc APN 11 11839462 missense probably damaging 1.00
IGL01336:Ddc APN 11 11846630 splice site probably null
IGL02257:Ddc APN 11 11873171 nonsense probably null
IGL02327:Ddc APN 11 11863739 missense probably damaging 0.98
IGL02516:Ddc APN 11 11829125 missense probably damaging 1.00
IGL02616:Ddc APN 11 11880645 utr 5 prime probably benign
IGL02888:Ddc APN 11 11822297 splice site probably benign
IGL03267:Ddc APN 11 11876303 missense probably damaging 1.00
R0454:Ddc UTSW 11 11880587 missense possibly damaging 0.88
R1061:Ddc UTSW 11 11829132 missense probably benign 0.00
R1173:Ddc UTSW 11 11846634 critical splice donor site probably null
R1382:Ddc UTSW 11 11824856 missense possibly damaging 0.52
R1549:Ddc UTSW 11 11846656 unclassified probably null
R1583:Ddc UTSW 11 11829131 missense probably benign 0.17
R1929:Ddc UTSW 11 11835764 missense probably damaging 1.00
R1970:Ddc UTSW 11 11815292 missense possibly damaging 0.87
R2034:Ddc UTSW 11 11880456 missense probably benign 0.40
R2270:Ddc UTSW 11 11835764 missense probably damaging 1.00
R2272:Ddc UTSW 11 11835764 missense probably damaging 1.00
R4449:Ddc UTSW 11 11835802 missense probably damaging 1.00
R4508:Ddc UTSW 11 11819393 critical splice acceptor site probably null
R4799:Ddc UTSW 11 11846632 splice site probably null
R5307:Ddc UTSW 11 11876321 missense probably damaging 1.00
R6654:Ddc UTSW 11 11880452 missense probably damaging 1.00
R6817:Ddc UTSW 11 11824854 missense probably damaging 1.00
R7001:Ddc UTSW 11 11824870 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TCCATGGAGGAGAGTCTACTG -3'
(R):5'- ATGCAGGACATTGCTCAGC -3'

Sequencing Primer
(F):5'- AGAGTCTACTGGGCCAGTCAG -3'
(R):5'- TGCTCAGCGCATGTGAATGAC -3'
Posted On2018-11-06