Incidental Mutation 'R6918:Kif1c'
ID539454
Institutional Source Beutler Lab
Gene Symbol Kif1c
Ensembl Gene ENSMUSG00000020821
Gene Namekinesin family member 1C
SynonymsB430105J22Rik, D11Bwg1349e, Orch3, N-3 kinsin
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6918 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location70700548-70731964 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 70706987 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 356 (E356K)
Ref Sequence ENSEMBL: ENSMUSP00000136258 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072187] [ENSMUST00000094499] [ENSMUST00000102554] [ENSMUST00000137119] [ENSMUST00000152618]
Predicted Effect probably damaging
Transcript: ENSMUST00000072187
AA Change: E356K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000072048
Gene: ENSMUSG00000020821
AA Change: E356K

DomainStartEndE-ValueType
KISc 3 356 6.18e-175 SMART
low complexity region 402 418 N/A INTRINSIC
FHA 522 575 1.45e-2 SMART
low complexity region 607 622 N/A INTRINSIC
coiled coil region 634 673 N/A INTRINSIC
coiled coil region 842 883 N/A INTRINSIC
low complexity region 955 975 N/A INTRINSIC
low complexity region 1009 1055 N/A INTRINSIC
low complexity region 1072 1100 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000094499
AA Change: E356K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000092075
Gene: ENSMUSG00000020821
AA Change: E356K

DomainStartEndE-ValueType
KISc 3 356 6.18e-175 SMART
low complexity region 402 418 N/A INTRINSIC
FHA 522 575 1.45e-2 SMART
low complexity region 607 622 N/A INTRINSIC
coiled coil region 634 671 N/A INTRINSIC
coiled coil region 830 871 N/A INTRINSIC
low complexity region 943 963 N/A INTRINSIC
low complexity region 997 1043 N/A INTRINSIC
low complexity region 1060 1088 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102554
AA Change: E356K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099614
Gene: ENSMUSG00000020821
AA Change: E356K

DomainStartEndE-ValueType
KISc 3 356 6.18e-175 SMART
low complexity region 402 418 N/A INTRINSIC
FHA 522 575 1.45e-2 SMART
low complexity region 607 622 N/A INTRINSIC
coiled coil region 634 671 N/A INTRINSIC
coiled coil region 830 871 N/A INTRINSIC
low complexity region 943 963 N/A INTRINSIC
low complexity region 997 1043 N/A INTRINSIC
low complexity region 1060 1088 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000137119
AA Change: E356K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123242
Gene: ENSMUSG00000020821
AA Change: E356K

DomainStartEndE-ValueType
KISc 3 356 6.18e-175 SMART
low complexity region 402 418 N/A INTRINSIC
FHA 522 575 1.45e-2 SMART
low complexity region 607 622 N/A INTRINSIC
coiled coil region 634 671 N/A INTRINSIC
coiled coil region 830 871 N/A INTRINSIC
low complexity region 943 963 N/A INTRINSIC
low complexity region 997 1043 N/A INTRINSIC
low complexity region 1060 1088 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000152618
AA Change: E356K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136258
Gene: ENSMUSG00000020821
AA Change: E356K

DomainStartEndE-ValueType
KISc 3 356 6.18e-175 SMART
Meta Mutation Damage Score 0.38 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the kinesin-like protein family. The family members are microtubule-dependent molecular motors that transport organelles within cells and move chromosomes during cell division. Mutations in this gene are a cause of spastic ataxia 2, autosomal recessive. [provided by RefSeq, May 2014]
PHENOTYPE: Mice homozygous for a reporter allele are viable, fertile and overtly normal and display normal motor-dependent retrograde Golgi apparatus-to-endoplasmic reticulum transport. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210011C24Rik T G 8: 84,011,684 M1L probably benign Het
Abca3 A C 17: 24,408,658 K1359Q probably damaging Het
Ace T C 11: 105,972,943 Y406H probably damaging Het
Acsl6 A G 11: 54,341,756 probably null Het
Alms1 T A 6: 85,622,661 Y1959N possibly damaging Het
BC037034 A G 5: 138,260,664 V211A probably benign Het
Chrna7 T A 7: 63,159,551 I76F probably benign Het
Cuedc1 C T 11: 88,187,073 T296I probably benign Het
Ddc A G 11: 11,819,307 V409A probably damaging Het
Dhx8 T A 11: 101,738,421 Y212* probably null Het
Dnah6 T A 6: 73,181,755 K622* probably null Het
Dscaml1 A G 9: 45,430,507 H72R probably benign Het
Dyrk1b A G 7: 28,185,925 D396G probably damaging Het
Gstm2 A G 3: 107,985,241 probably null Het
Hsd3b1 A G 3: 98,853,109 Y189H probably damaging Het
Kirrel2 A C 7: 30,450,814 C17G probably damaging Het
Klhl12 A G 1: 134,475,846 H259R possibly damaging Het
Krt1 A G 15: 101,850,177 V184A probably damaging Het
Lmod2 A T 6: 24,603,595 N190Y probably benign Het
Lrp2 A C 2: 69,489,305 V1958G probably damaging Het
Ly6h T C 15: 75,565,658 S37G probably damaging Het
Man2a2 A T 7: 80,353,192 H1056Q possibly damaging Het
Mixl1 T A 1: 180,694,678 I213F probably benign Het
Morc3 T C 16: 93,853,135 I268T probably benign Het
Mtx2 C T 2: 74,876,353 T224I probably damaging Het
Olfr893 G A 9: 38,209,652 V198M possibly damaging Het
Oscp1 A C 4: 126,076,778 D120A possibly damaging Het
Parp1 G A 1: 180,588,670 V545I possibly damaging Het
Pipox A G 11: 77,881,554 I330T probably damaging Het
Pkp2 A G 16: 16,272,218 Y790C probably damaging Het
Pomt1 T A 2: 32,252,861 probably null Het
Pp2d1 G A 17: 53,515,459 T193M probably damaging Het
Prkra G T 2: 76,630,453 H300Q probably damaging Het
Ror2 T G 13: 53,111,451 N523T probably damaging Het
Rp1 A T 1: 3,999,608 D1355E unknown Het
Rsph4a T C 10: 33,905,276 Y41H probably benign Het
Scn1a T A 2: 66,332,213 I230F probably damaging Het
Taar7e T A 10: 24,037,615 M1K probably null Het
Tex15 T G 8: 33,573,184 L1155V probably benign Het
Tmprss3 T C 17: 31,188,357 K321E probably benign Het
Tsc2 A T 17: 24,613,229 C728S probably damaging Het
Ube2e3 A T 2: 78,920,039 K203M probably damaging Het
Unc50 A T 1: 37,438,702 T222S probably damaging Het
Vmn1r236 A T 17: 21,287,616 H332L probably benign Het
Vmn2r7 G A 3: 64,691,339 T599I probably benign Het
Zfp334 A T 2: 165,381,879 D81E possibly damaging Het
Zfp710 A G 7: 80,082,040 I322V possibly damaging Het
Other mutations in Kif1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00775:Kif1c APN 11 70724134 splice site probably null
IGL00817:Kif1c APN 11 70705253 missense probably benign 0.25
IGL00849:Kif1c APN 11 70706127 missense probably damaging 1.00
IGL01988:Kif1c APN 11 70704936 missense probably damaging 1.00
IGL02683:Kif1c APN 11 70726452 missense possibly damaging 0.85
IGL03024:Kif1c APN 11 70705189 missense probably damaging 1.00
R0570:Kif1c UTSW 11 70704465 missense probably damaging 0.96
R0647:Kif1c UTSW 11 70726141 missense probably damaging 1.00
R0710:Kif1c UTSW 11 70726497 missense probably benign
R1112:Kif1c UTSW 11 70724815 splice site probably null
R1199:Kif1c UTSW 11 70708601 missense possibly damaging 0.69
R1514:Kif1c UTSW 11 70705729 missense probably damaging 1.00
R1660:Kif1c UTSW 11 70728397 missense probably damaging 0.99
R1661:Kif1c UTSW 11 70728397 missense probably damaging 0.99
R1666:Kif1c UTSW 11 70728397 missense probably damaging 0.99
R1669:Kif1c UTSW 11 70728397 missense probably damaging 0.99
R1707:Kif1c UTSW 11 70728397 missense probably damaging 0.99
R1708:Kif1c UTSW 11 70728397 missense probably damaging 0.99
R1835:Kif1c UTSW 11 70708971 missense probably damaging 0.99
R1861:Kif1c UTSW 11 70703342 missense probably damaging 1.00
R2870:Kif1c UTSW 11 70724081 missense probably damaging 0.99
R2870:Kif1c UTSW 11 70724081 missense probably damaging 0.99
R2871:Kif1c UTSW 11 70724081 missense probably damaging 0.99
R2871:Kif1c UTSW 11 70724081 missense probably damaging 0.99
R2872:Kif1c UTSW 11 70724081 missense probably damaging 0.99
R2872:Kif1c UTSW 11 70724081 missense probably damaging 0.99
R2927:Kif1c UTSW 11 70726314 missense probably benign
R3720:Kif1c UTSW 11 70703771 missense possibly damaging 0.94
R4809:Kif1c UTSW 11 70726357 missense probably benign 0.10
R4914:Kif1c UTSW 11 70708855 missense probably damaging 0.99
R5642:Kif1c UTSW 11 70708447 missense probably benign 0.14
R5788:Kif1c UTSW 11 70708828 missense probably damaging 1.00
R5861:Kif1c UTSW 11 70703795 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAACTCTGAGGCTGATCAGTC -3'
(R):5'- GTTTAATGGAGAGTGGACCTCC -3'

Sequencing Primer
(F):5'- CTCTGAGGCTGATCAGTCATAAG -3'
(R):5'- TCCACACACTCCAGGACTG -3'
Posted On2018-11-06