Incidental Mutation 'R6918:Morc3'
ID539463
Institutional Source Beutler Lab
Gene Symbol Morc3
Ensembl Gene ENSMUSG00000039456
Gene Namemicrorchidia 3
SynonymsZcwcc3, 1110051N18Rik, 1110051N18Rik, D16Jhu32e
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6918 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location93832121-93876073 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 93853135 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 268 (I268T)
Ref Sequence ENSEMBL: ENSMUSP00000144369 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044068] [ENSMUST00000201097] [ENSMUST00000201754] [ENSMUST00000202261]
Predicted Effect probably benign
Transcript: ENSMUST00000044068
AA Change: I268T

PolyPhen 2 Score 0.364 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000040152
Gene: ENSMUSG00000039456
AA Change: I268T

DomainStartEndE-ValueType
Pfam:HATPase_c 25 130 8e-8 PFAM
Pfam:HATPase_c_3 26 164 1.1e-18 PFAM
Pfam:zf-CW 409 452 2.7e-19 PFAM
low complexity region 461 472 N/A INTRINSIC
low complexity region 630 639 N/A INTRINSIC
coiled coil region 765 871 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201097
AA Change: I197T

PolyPhen 2 Score 0.364 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000144058
Gene: ENSMUSG00000039456
AA Change: I197T

DomainStartEndE-ValueType
Blast:HATPase_c 1 70 4e-39 BLAST
Pfam:zf-CW 340 383 1.2e-16 PFAM
low complexity region 392 403 N/A INTRINSIC
low complexity region 557 566 N/A INTRINSIC
coiled coil region 692 798 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201754
SMART Domains Protein: ENSMUSP00000144357
Gene: ENSMUSG00000039456

DomainStartEndE-ValueType
Pfam:HATPase_c 25 91 1.3e-6 PFAM
Pfam:HATPase_c_3 26 92 1.2e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000202261
AA Change: I268T

PolyPhen 2 Score 0.364 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000144369
Gene: ENSMUSG00000039456
AA Change: I268T

DomainStartEndE-ValueType
Pfam:HATPase_c 25 130 8e-8 PFAM
Pfam:HATPase_c_3 26 164 1.1e-18 PFAM
Pfam:zf-CW 409 452 2.7e-19 PFAM
low complexity region 461 472 N/A INTRINSIC
low complexity region 630 639 N/A INTRINSIC
coiled coil region 765 871 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that localizes to the nuclear matrix and forms nuclear bodies via an ATP-dependent mechanism. The protein is predicted to have coiled-coil and zinc finger domains and has RNA binding activity. Alternative splicing produces multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a null allele die at or within a day of birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210011C24Rik T G 8: 84,011,684 M1L probably benign Het
Abca3 A C 17: 24,408,658 K1359Q probably damaging Het
Ace T C 11: 105,972,943 Y406H probably damaging Het
Acsl6 A G 11: 54,341,756 probably null Het
Alms1 T A 6: 85,622,661 Y1959N possibly damaging Het
BC037034 A G 5: 138,260,664 V211A probably benign Het
Chrna7 T A 7: 63,159,551 I76F probably benign Het
Cuedc1 C T 11: 88,187,073 T296I probably benign Het
Ddc A G 11: 11,819,307 V409A probably damaging Het
Dhx8 T A 11: 101,738,421 Y212* probably null Het
Dnah6 T A 6: 73,181,755 K622* probably null Het
Dscaml1 A G 9: 45,430,507 H72R probably benign Het
Dyrk1b A G 7: 28,185,925 D396G probably damaging Het
Gstm2 A G 3: 107,985,241 probably null Het
Hsd3b1 A G 3: 98,853,109 Y189H probably damaging Het
Kif1c G A 11: 70,706,987 E356K probably damaging Het
Kirrel2 A C 7: 30,450,814 C17G probably damaging Het
Klhl12 A G 1: 134,475,846 H259R possibly damaging Het
Krt1 A G 15: 101,850,177 V184A probably damaging Het
Lmod2 A T 6: 24,603,595 N190Y probably benign Het
Lrp2 A C 2: 69,489,305 V1958G probably damaging Het
Ly6h T C 15: 75,565,658 S37G probably damaging Het
Man2a2 A T 7: 80,353,192 H1056Q possibly damaging Het
Mixl1 T A 1: 180,694,678 I213F probably benign Het
Mtx2 C T 2: 74,876,353 T224I probably damaging Het
Olfr893 G A 9: 38,209,652 V198M possibly damaging Het
Oscp1 A C 4: 126,076,778 D120A possibly damaging Het
Parp1 G A 1: 180,588,670 V545I possibly damaging Het
Pipox A G 11: 77,881,554 I330T probably damaging Het
Pkp2 A G 16: 16,272,218 Y790C probably damaging Het
Pomt1 T A 2: 32,252,861 probably null Het
Pp2d1 G A 17: 53,515,459 T193M probably damaging Het
Prkra G T 2: 76,630,453 H300Q probably damaging Het
Ror2 T G 13: 53,111,451 N523T probably damaging Het
Rp1 A T 1: 3,999,608 D1355E unknown Het
Rsph4a T C 10: 33,905,276 Y41H probably benign Het
Scn1a T A 2: 66,332,213 I230F probably damaging Het
Taar7e T A 10: 24,037,615 M1K probably null Het
Tex15 T G 8: 33,573,184 L1155V probably benign Het
Tmprss3 T C 17: 31,188,357 K321E probably benign Het
Tsc2 A T 17: 24,613,229 C728S probably damaging Het
Ube2e3 A T 2: 78,920,039 K203M probably damaging Het
Unc50 A T 1: 37,438,702 T222S probably damaging Het
Vmn1r236 A T 17: 21,287,616 H332L probably benign Het
Vmn2r7 G A 3: 64,691,339 T599I probably benign Het
Zfp334 A T 2: 165,381,879 D81E possibly damaging Het
Zfp710 A G 7: 80,082,040 I322V possibly damaging Het
Other mutations in Morc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00561:Morc3 APN 16 93873395 critical splice donor site probably null
IGL01015:Morc3 APN 16 93862646 missense probably damaging 1.00
IGL01374:Morc3 APN 16 93844213 missense probably damaging 1.00
IGL01634:Morc3 APN 16 93873237 missense probably benign 0.02
IGL01845:Morc3 APN 16 93860567 missense probably damaging 0.96
IGL02202:Morc3 APN 16 93870861 missense probably benign 0.01
IGL02478:Morc3 APN 16 93864956 splice site probably benign
IGL03026:Morc3 APN 16 93862724 splice site probably benign
IGL03115:Morc3 APN 16 93871083 missense probably damaging 0.99
mindy UTSW 16 93866533 missense probably benign 0.03
Pfaff UTSW 16 93862684 missense probably damaging 0.96
shield UTSW 16 93874812 missense probably damaging 0.98
stooges UTSW 16 93841387 missense probably damaging 1.00
sword UTSW 16 93874757 critical splice acceptor site probably null
R0173:Morc3 UTSW 16 93832206 utr 5 prime probably null
R0413:Morc3 UTSW 16 93870474 missense probably damaging 1.00
R0639:Morc3 UTSW 16 93853850 missense probably damaging 1.00
R0842:Morc3 UTSW 16 93873396 critical splice donor site probably null
R1134:Morc3 UTSW 16 93870669 missense probably benign
R1162:Morc3 UTSW 16 93853108 missense probably damaging 1.00
R1498:Morc3 UTSW 16 93853855 missense probably damaging 1.00
R1520:Morc3 UTSW 16 93844241 missense probably damaging 0.96
R1603:Morc3 UTSW 16 93866503 missense probably benign
R1622:Morc3 UTSW 16 93874806 missense probably benign 0.28
R1630:Morc3 UTSW 16 93866533 missense probably benign 0.03
R1818:Morc3 UTSW 16 93855510 missense probably damaging 1.00
R1902:Morc3 UTSW 16 93870497 missense probably damaging 1.00
R2090:Morc3 UTSW 16 93866453 missense probably benign 0.23
R2261:Morc3 UTSW 16 93853221 splice site probably benign
R2360:Morc3 UTSW 16 93841387 missense probably damaging 1.00
R2407:Morc3 UTSW 16 93844327 critical splice donor site probably null
R2519:Morc3 UTSW 16 93862539 splice site probably null
R3736:Morc3 UTSW 16 93874812 missense probably damaging 0.98
R3873:Morc3 UTSW 16 93862436 missense probably damaging 0.99
R4114:Morc3 UTSW 16 93873339 missense probably benign 0.01
R4115:Morc3 UTSW 16 93873339 missense probably benign 0.01
R4116:Morc3 UTSW 16 93873339 missense probably benign 0.01
R4472:Morc3 UTSW 16 93874757 critical splice acceptor site probably null
R4609:Morc3 UTSW 16 93864968 missense probably benign 0.01
R4708:Morc3 UTSW 16 93873238 missense probably benign 0.19
R4883:Morc3 UTSW 16 93870362 critical splice acceptor site probably null
R4945:Morc3 UTSW 16 93871194 missense probably damaging 1.00
R4965:Morc3 UTSW 16 93860587 nonsense probably null
R5399:Morc3 UTSW 16 93862539 splice site probably null
R5481:Morc3 UTSW 16 93862655 missense probably damaging 0.99
R5540:Morc3 UTSW 16 93847380 missense probably benign
R5970:Morc3 UTSW 16 93866453 missense possibly damaging 0.65
R6006:Morc3 UTSW 16 93866493 missense possibly damaging 0.67
R6044:Morc3 UTSW 16 93866442 missense probably benign 0.02
R6045:Morc3 UTSW 16 93874845 missense probably damaging 1.00
R6155:Morc3 UTSW 16 93862425 missense possibly damaging 0.94
R6165:Morc3 UTSW 16 93841383 missense probably damaging 1.00
R6225:Morc3 UTSW 16 93845194 nonsense probably null
R6240:Morc3 UTSW 16 93862684 missense probably damaging 0.96
R6835:Morc3 UTSW 16 93847421 missense probably damaging 1.00
R6944:Morc3 UTSW 16 93870572 missense probably benign
R7311:Morc3 UTSW 16 93849173 missense probably damaging 1.00
R7398:Morc3 UTSW 16 93874860 missense probably damaging 1.00
R7553:Morc3 UTSW 16 93870936 missense not run
X0023:Morc3 UTSW 16 93847399 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCATGTTTACCTCTGAACTATGC -3'
(R):5'- TGGAGCGTGGAACTCTATGAG -3'

Sequencing Primer
(F):5'- GTCCTGGAACTCACTGTGTAGAC -3'
(R):5'- AAGGACTCCTGCAAGTTGTC -3'
Posted On2018-11-06