Incidental Mutation 'R6918:Pp2d1'
ID539468
Institutional Source Beutler Lab
Gene Symbol Pp2d1
Ensembl Gene ENSMUSG00000044957
Gene Nameprotein phosphatase 2C-like domain containing 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R6918 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location53507460-53539451 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 53515459 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 193 (T193M)
Ref Sequence ENSEMBL: ENSMUSP00000056682 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056198]
Predicted Effect probably damaging
Transcript: ENSMUST00000056198
AA Change: T193M

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000056682
Gene: ENSMUSG00000044957
AA Change: T193M

DomainStartEndE-ValueType
PP2Cc 173 609 4.04e-18 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 100% (48/48)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210011C24Rik T G 8: 84,011,684 M1L probably benign Het
Abca3 A C 17: 24,408,658 K1359Q probably damaging Het
Ace T C 11: 105,972,943 Y406H probably damaging Het
Acsl6 A G 11: 54,341,756 probably null Het
Alms1 T A 6: 85,622,661 Y1959N possibly damaging Het
BC037034 A G 5: 138,260,664 V211A probably benign Het
Chrna7 T A 7: 63,159,551 I76F probably benign Het
Cuedc1 C T 11: 88,187,073 T296I probably benign Het
Ddc A G 11: 11,819,307 V409A probably damaging Het
Dhx8 T A 11: 101,738,421 Y212* probably null Het
Dnah6 T A 6: 73,181,755 K622* probably null Het
Dscaml1 A G 9: 45,430,507 H72R probably benign Het
Dyrk1b A G 7: 28,185,925 D396G probably damaging Het
Gstm2 A G 3: 107,985,241 probably null Het
Hsd3b1 A G 3: 98,853,109 Y189H probably damaging Het
Kif1c G A 11: 70,706,987 E356K probably damaging Het
Kirrel2 A C 7: 30,450,814 C17G probably damaging Het
Klhl12 A G 1: 134,475,846 H259R possibly damaging Het
Krt1 A G 15: 101,850,177 V184A probably damaging Het
Lmod2 A T 6: 24,603,595 N190Y probably benign Het
Lrp2 A C 2: 69,489,305 V1958G probably damaging Het
Ly6h T C 15: 75,565,658 S37G probably damaging Het
Man2a2 A T 7: 80,353,192 H1056Q possibly damaging Het
Mixl1 T A 1: 180,694,678 I213F probably benign Het
Morc3 T C 16: 93,853,135 I268T probably benign Het
Mtx2 C T 2: 74,876,353 T224I probably damaging Het
Olfr893 G A 9: 38,209,652 V198M possibly damaging Het
Oscp1 A C 4: 126,076,778 D120A possibly damaging Het
Parp1 G A 1: 180,588,670 V545I possibly damaging Het
Pipox A G 11: 77,881,554 I330T probably damaging Het
Pkp2 A G 16: 16,272,218 Y790C probably damaging Het
Pomt1 T A 2: 32,252,861 probably null Het
Prkra G T 2: 76,630,453 H300Q probably damaging Het
Ror2 T G 13: 53,111,451 N523T probably damaging Het
Rp1 A T 1: 3,999,608 D1355E unknown Het
Rsph4a T C 10: 33,905,276 Y41H probably benign Het
Scn1a T A 2: 66,332,213 I230F probably damaging Het
Taar7e T A 10: 24,037,615 M1K probably null Het
Tex15 T G 8: 33,573,184 L1155V probably benign Het
Tmprss3 T C 17: 31,188,357 K321E probably benign Het
Tsc2 A T 17: 24,613,229 C728S probably damaging Het
Ube2e3 A T 2: 78,920,039 K203M probably damaging Het
Unc50 A T 1: 37,438,702 T222S probably damaging Het
Vmn1r236 A T 17: 21,287,616 H332L probably benign Het
Vmn2r7 G A 3: 64,691,339 T599I probably benign Het
Zfp334 A T 2: 165,381,879 D81E possibly damaging Het
Zfp710 A G 7: 80,082,040 I322V possibly damaging Het
Other mutations in Pp2d1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00949:Pp2d1 APN 17 53515639 missense probably benign 0.00
IGL01939:Pp2d1 APN 17 53515139 missense probably damaging 1.00
IGL02031:Pp2d1 APN 17 53508440 missense probably damaging 1.00
IGL02039:Pp2d1 APN 17 53515994 nonsense probably null
IGL02108:Pp2d1 APN 17 53515405 missense probably damaging 1.00
IGL02121:Pp2d1 APN 17 53507921 missense probably damaging 1.00
IGL03034:Pp2d1 APN 17 53508053 missense possibly damaging 0.88
R0483:Pp2d1 UTSW 17 53507971 missense probably benign 0.29
R0562:Pp2d1 UTSW 17 53539168 splice site probably benign
R1416:Pp2d1 UTSW 17 53515807 missense probably benign 0.07
R1464:Pp2d1 UTSW 17 53515987 missense possibly damaging 0.94
R1464:Pp2d1 UTSW 17 53515987 missense possibly damaging 0.94
R1479:Pp2d1 UTSW 17 53507855 missense probably benign 0.05
R1659:Pp2d1 UTSW 17 53515378 missense possibly damaging 0.50
R1711:Pp2d1 UTSW 17 53515310 missense possibly damaging 0.47
R2214:Pp2d1 UTSW 17 53515396 missense probably benign 0.01
R2217:Pp2d1 UTSW 17 53515454 missense probably benign 0.02
R2218:Pp2d1 UTSW 17 53515454 missense probably benign 0.02
R4463:Pp2d1 UTSW 17 53515858 missense probably benign
R4644:Pp2d1 UTSW 17 53515987 missense probably benign 0.00
R4901:Pp2d1 UTSW 17 53515009 missense probably benign 0.20
R5164:Pp2d1 UTSW 17 53508070 missense probably benign 0.11
R5169:Pp2d1 UTSW 17 53507902 missense possibly damaging 0.78
R5186:Pp2d1 UTSW 17 53508140 missense probably benign
R5223:Pp2d1 UTSW 17 53507845 missense probably benign 0.12
R6550:Pp2d1 UTSW 17 53515576 missense probably damaging 0.98
R7263:Pp2d1 UTSW 17 53515330 missense probably benign 0.00
X0019:Pp2d1 UTSW 17 53515547 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- AGTTGCTTCTGCTCAGCTG -3'
(R):5'- GCCCAAACTGGTCAGTCTTC -3'

Sequencing Primer
(F):5'- CAGCTGTCATTTGGTAGGAAGGATC -3'
(R):5'- CCAAACTGGTCAGTCTTCATAGAGAG -3'
Posted On2018-11-06