Incidental Mutation 'R6919:Speg'
ID539470
Institutional Source Beutler Lab
Gene Symbol Speg
Ensembl Gene ENSMUSG00000026207
Gene NameSPEG complex locus
SynonymsSPEGbeta, Apeg1, SPEGalpha, D1Bwg1450e, SPEG, BPEG
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6919 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location75375297-75432320 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 75387908 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 156 (L156*)
Ref Sequence ENSEMBL: ENSMUSP00000116953 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087122] [ENSMUST00000113590] [ENSMUST00000125306] [ENSMUST00000148515]
Predicted Effect probably null
Transcript: ENSMUST00000087122
AA Change: L311*
SMART Domains Protein: ENSMUSP00000084361
Gene: ENSMUSG00000026207
AA Change: L311*

DomainStartEndE-ValueType
IG 51 128 1.48e-6 SMART
low complexity region 292 318 N/A INTRINSIC
low complexity region 325 338 N/A INTRINSIC
low complexity region 359 368 N/A INTRINSIC
low complexity region 412 423 N/A INTRINSIC
low complexity region 573 584 N/A INTRINSIC
IGc2 739 806 2.19e-9 SMART
Pfam:SPEG_u2 817 873 2.4e-36 PFAM
IGc2 886 954 4.03e-8 SMART
IG 979 1064 1.05e-6 SMART
IGc2 1081 1148 2.19e-9 SMART
IG 1199 1283 6.87e-2 SMART
FN3 1287 1373 1.38e-4 SMART
IG 1401 1487 2.64e-3 SMART
IGc2 1502 1569 1.12e-6 SMART
STYKc 1606 1859 8.44e-63 SMART
Blast:STYKc 1861 1895 6e-12 BLAST
low complexity region 1918 1939 N/A INTRINSIC
low complexity region 2069 2081 N/A INTRINSIC
low complexity region 2208 2227 N/A INTRINSIC
low complexity region 2230 2249 N/A INTRINSIC
low complexity region 2255 2269 N/A INTRINSIC
low complexity region 2343 2366 N/A INTRINSIC
low complexity region 2410 2422 N/A INTRINSIC
low complexity region 2433 2451 N/A INTRINSIC
low complexity region 2457 2487 N/A INTRINSIC
low complexity region 2524 2544 N/A INTRINSIC
IGc2 2599 2667 2.05e-9 SMART
FN3 2681 2760 2.5e-2 SMART
low complexity region 2775 2789 N/A INTRINSIC
low complexity region 2802 2831 N/A INTRINSIC
low complexity region 2912 2927 N/A INTRINSIC
STYKc 2961 3213 4.42e-66 SMART
low complexity region 3241 3250 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000113590
AA Change: L205*
SMART Domains Protein: ENSMUSP00000109220
Gene: ENSMUSG00000026207
AA Change: L205*

DomainStartEndE-ValueType
low complexity region 186 212 N/A INTRINSIC
low complexity region 219 232 N/A INTRINSIC
low complexity region 253 262 N/A INTRINSIC
low complexity region 306 317 N/A INTRINSIC
low complexity region 467 478 N/A INTRINSIC
IGc2 633 700 2.19e-9 SMART
low complexity region 752 764 N/A INTRINSIC
IGc2 780 848 4.03e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125306
Predicted Effect probably benign
Transcript: ENSMUST00000132228
Predicted Effect probably null
Transcript: ENSMUST00000137868
AA Change: L58*
Predicted Effect probably null
Transcript: ENSMUST00000148515
AA Change: L156*
SMART Domains Protein: ENSMUSP00000116953
Gene: ENSMUSG00000026207
AA Change: L156*

DomainStartEndE-ValueType
low complexity region 113 126 N/A INTRINSIC
low complexity region 137 163 N/A INTRINSIC
low complexity region 170 183 N/A INTRINSIC
low complexity region 204 213 N/A INTRINSIC
low complexity region 257 268 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.8%
Validation Efficiency 99% (84/85)
MGI Phenotype FUNCTION: This gene encodes a protein with similarity to members of the myosin light chain kinase family. This protein family is required for myocyte cytoskeletal development. Studies have determined that a lack of this protein affected myocardial development. Multiple alternatively spliced transcript variants that encode different protein isoforms have been defined. [provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a knock-out allele die during the early postnatal period with enlarged, dilated hearts, and decreased cardiac function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700086D15Rik A G 11: 65,152,530 probably benign Het
4931408C20Rik T C 1: 26,682,934 Y1055C probably benign Het
6430548M08Rik T C 8: 120,145,482 S50P probably damaging Het
Aacs A G 5: 125,506,163 D261G probably benign Het
Abcc4 T A 14: 118,594,894 T775S probably benign Het
Acsl6 A G 11: 54,341,756 probably null Het
Agbl5 T A 5: 30,904,717 F196I probably benign Het
Ahnak2 T C 12: 112,774,684 T985A possibly damaging Het
Ak1 A T 2: 32,631,122 D101V possibly damaging Het
Alx1 A G 10: 103,025,200 Y156H probably damaging Het
Angptl7 T A 4: 148,500,031 S87C probably benign Het
Ankrd36 A G 11: 5,629,299 T188A probably benign Het
Arhgap11a A C 2: 113,839,709 S356R possibly damaging Het
Ascc3 G T 10: 50,645,753 E455* probably null Het
Atp6v0a2 G A 5: 124,712,161 probably null Het
B3gnt7 T C 1: 86,305,694 W104R probably damaging Het
Bbs9 G A 9: 22,812,544 probably null Het
Cc2d2a T A 5: 43,703,215 D544E probably benign Het
Cic C T 7: 25,271,777 T311I probably benign Het
Cngb1 T A 8: 95,248,375 R1157W probably null Het
Cntln A G 4: 85,115,368 H1310R probably benign Het
Cntnap5c A T 17: 58,293,953 I764F probably benign Het
Col26a1 T C 5: 136,744,234 Q362R possibly damaging Het
Cyp2c29 G A 19: 39,291,141 R100K probably benign Het
D17H6S53E C G 17: 35,127,246 D44E probably damaging Het
Dap3 A G 3: 88,930,989 V65A probably damaging Het
Dna2 A T 10: 62,957,003 I266F probably damaging Het
Dnah14 G A 1: 181,585,066 G57E probably benign Het
Dock9 A T 14: 121,643,152 V333E probably benign Het
Dpm1 A G 2: 168,230,275 Y27H probably damaging Het
Dsp A T 13: 38,167,655 Y150F possibly damaging Het
Emilin3 A T 2: 160,908,098 I577N probably damaging Het
Erap1 A G 13: 74,671,433 T189A probably benign Het
Fam208a T A 14: 27,449,801 L397* probably null Het
Fat2 A G 11: 55,282,771 I2372T possibly damaging Het
Fbn2 A T 18: 58,124,187 probably null Het
Gnl1 A T 17: 35,987,533 R390* probably null Het
Hivep1 A G 13: 42,183,452 I2336V probably benign Het
Il17rb C G 14: 30,004,271 probably null Het
Itga9 T C 9: 118,887,815 W396R probably damaging Het
Katnal2 A G 18: 77,011,038 V152A probably benign Het
Kcnk3 A G 5: 30,622,400 T265A probably benign Het
Klhl1 T C 14: 96,136,594 Y672C probably benign Het
Leng8 C A 7: 4,143,626 N412K possibly damaging Het
Lrrc9 T A 12: 72,506,393 F1356L probably benign Het
Map7 A G 10: 20,171,082 probably benign Het
Mei1 T C 15: 82,081,930 F251S probably damaging Het
Mia2 A G 12: 59,129,895 E9G possibly damaging Het
Ms4a13 C A 19: 11,171,885 W182C probably benign Het
Muc16 C T 9: 18,660,299 R308K unknown Het
Olfr1195 G A 2: 88,683,684 T16I possibly damaging Het
Olfr936 A G 9: 39,047,531 probably benign Het
Pcnt A G 10: 76,385,798 V1998A probably benign Het
Pgm1 A T 5: 64,097,025 N51I probably benign Het
Piezo1 T A 8: 122,490,281 H1333L probably damaging Het
Prg2 G A 2: 84,983,256 V199M probably damaging Het
Prss51 T C 14: 64,097,488 V182A probably damaging Het
Psmb9 A T 17: 34,183,225 Y132* probably null Het
Ralyl T C 3: 13,777,031 Y76H probably damaging Het
Rnaset2a A T 17: 8,130,282 D174E probably benign Het
Rnft1 G A 11: 86,495,330 probably null Het
Robo2 T C 16: 73,961,867 Y676C probably damaging Het
Samd9l T G 6: 3,376,313 Y316S possibly damaging Het
Siah3 T A 14: 75,456,138 F28Y possibly damaging Het
Slc28a3 C T 13: 58,573,443 probably null Het
Slc8a1 A G 17: 81,388,872 F911S probably damaging Het
Spopl T G 2: 23,517,861 M269L probably benign Het
Tacr1 C T 6: 82,557,073 T360I probably benign Het
Tmem262 A G 19: 6,080,737 E95G probably benign Het
Tmem68 G T 4: 3,569,669 T7N possibly damaging Het
Top3a T A 11: 60,749,493 I460F probably damaging Het
Trafd1 G A 5: 121,384,074 R5* probably null Het
Trim16 T A 11: 62,840,869 V435D possibly damaging Het
Tspan17 A G 13: 54,796,033 D236G probably damaging Het
Tssk2 A T 16: 17,899,701 M323L probably benign Het
Ubqln5 A G 7: 104,129,008 V203A probably benign Het
Utrn A T 10: 12,693,470 L1134* probably null Het
Vmn1r37 C T 6: 66,731,720 S73F possibly damaging Het
Vps13c A G 9: 67,927,452 K1688E probably damaging Het
Zbtb39 A G 10: 127,741,842 D95G probably damaging Het
Zfhx3 T A 8: 108,800,528 I1019N probably damaging Het
Zfp207 C T 11: 80,395,503 probably benign Het
Zmiz1 C T 14: 25,643,638 T169M probably damaging Het
Other mutations in Speg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00838:Speg APN 1 75410390 missense possibly damaging 0.95
IGL00979:Speg APN 1 75410734 missense probably damaging 0.98
IGL01122:Speg APN 1 75410035 missense probably damaging 1.00
IGL01293:Speg APN 1 75388102 missense probably damaging 1.00
IGL01304:Speg APN 1 75428197 missense probably benign 0.00
IGL01351:Speg APN 1 75411276 splice site probably benign
IGL01473:Speg APN 1 75428285 missense possibly damaging 0.53
IGL01477:Speg APN 1 75391897 missense probably damaging 1.00
IGL01485:Speg APN 1 75387827 missense probably damaging 1.00
IGL01584:Speg APN 1 75430937 missense probably damaging 1.00
IGL01959:Speg APN 1 75391090 missense probably damaging 1.00
IGL02231:Speg APN 1 75423387 missense probably damaging 1.00
IGL02355:Speg APN 1 75423915 missense possibly damaging 0.49
IGL02362:Speg APN 1 75423915 missense possibly damaging 0.49
IGL03013:Speg APN 1 75431279 missense probably damaging 0.97
IGL03168:Speg APN 1 75388187 missense probably damaging 1.00
H8562:Speg UTSW 1 75415597 missense probably benign 0.39
R0112:Speg UTSW 1 75385032 missense possibly damaging 0.92
R0311:Speg UTSW 1 75430937 missense probably damaging 1.00
R0315:Speg UTSW 1 75415136 missense possibly damaging 0.88
R0393:Speg UTSW 1 75423924 missense possibly damaging 0.46
R0403:Speg UTSW 1 75430784 splice site probably benign
R0483:Speg UTSW 1 75385032 missense possibly damaging 0.92
R0648:Speg UTSW 1 75427978 missense probably benign
R0683:Speg UTSW 1 75429118 missense probably damaging 1.00
R0800:Speg UTSW 1 75423489 missense probably damaging 1.00
R0815:Speg UTSW 1 75415392 missense probably damaging 1.00
R0835:Speg UTSW 1 75375674 missense probably benign 0.00
R0866:Speg UTSW 1 75417083 missense probably damaging 0.99
R0880:Speg UTSW 1 75405061 missense probably damaging 1.00
R1082:Speg UTSW 1 75415138 missense possibly damaging 0.94
R1140:Speg UTSW 1 75429095 missense probably damaging 1.00
R1252:Speg UTSW 1 75427095 missense probably damaging 1.00
R1301:Speg UTSW 1 75401501 missense probably damaging 1.00
R1348:Speg UTSW 1 75422872 missense probably damaging 0.99
R1388:Speg UTSW 1 75430460 missense probably damaging 0.99
R1465:Speg UTSW 1 75428484 splice site probably benign
R1505:Speg UTSW 1 75375542 missense probably benign 0.02
R1506:Speg UTSW 1 75417663 missense probably benign 0.03
R1531:Speg UTSW 1 75401222 missense possibly damaging 0.86
R1543:Speg UTSW 1 75421951 missense probably damaging 1.00
R1567:Speg UTSW 1 75428047 missense probably benign
R1630:Speg UTSW 1 75422977 missense probably damaging 1.00
R1667:Speg UTSW 1 75410549 splice site probably benign
R1673:Speg UTSW 1 75411163 missense possibly damaging 0.60
R1718:Speg UTSW 1 75417863 missense probably benign 0.00
R1718:Speg UTSW 1 75421744 missense possibly damaging 0.87
R1719:Speg UTSW 1 75417863 missense probably benign 0.00
R1759:Speg UTSW 1 75401162 missense possibly damaging 0.95
R1861:Speg UTSW 1 75389005 missense probably damaging 1.00
R1874:Speg UTSW 1 75423906 missense probably benign
R1936:Speg UTSW 1 75431408 missense possibly damaging 0.93
R2192:Speg UTSW 1 75417727 missense probably damaging 1.00
R2204:Speg UTSW 1 75430477 missense probably benign 0.30
R2287:Speg UTSW 1 75430465 missense possibly damaging 0.76
R2696:Speg UTSW 1 75406926 missense probably benign 0.27
R2983:Speg UTSW 1 75384930 missense possibly damaging 0.83
R3110:Speg UTSW 1 75422682 nonsense probably null
R3112:Speg UTSW 1 75422682 nonsense probably null
R3154:Speg UTSW 1 75401542 missense probably damaging 1.00
R3720:Speg UTSW 1 75426782 missense probably damaging 1.00
R3983:Speg UTSW 1 75422547 missense probably benign 0.27
R4133:Speg UTSW 1 75427904 missense probably benign
R4522:Speg UTSW 1 75428330 missense probably damaging 1.00
R4564:Speg UTSW 1 75391834 missense probably damaging 1.00
R4577:Speg UTSW 1 75415395 missense probably damaging 1.00
R4858:Speg UTSW 1 75421735 missense probably damaging 1.00
R4953:Speg UTSW 1 75423864 missense possibly damaging 0.72
R4965:Speg UTSW 1 75427703 missense probably damaging 1.00
R4967:Speg UTSW 1 75387869 missense probably damaging 1.00
R5152:Speg UTSW 1 75428098 missense possibly damaging 0.92
R5156:Speg UTSW 1 75428087 missense probably damaging 0.99
R5371:Speg UTSW 1 75431393 missense possibly damaging 0.50
R5550:Speg UTSW 1 75429100 missense probably damaging 1.00
R5562:Speg UTSW 1 75427056 missense probably damaging 1.00
R5687:Speg UTSW 1 75419129 splice site probably null
R5985:Speg UTSW 1 75406684 missense possibly damaging 0.94
R6004:Speg UTSW 1 75415603 nonsense probably null
R6038:Speg UTSW 1 75418459 critical splice donor site probably null
R6038:Speg UTSW 1 75418459 critical splice donor site probably null
R6143:Speg UTSW 1 75414387 missense probably damaging 1.00
R6265:Speg UTSW 1 75406679 nonsense probably null
R6347:Speg UTSW 1 75426875 missense probably benign 0.00
R6453:Speg UTSW 1 75417972 missense probably benign 0.06
R6505:Speg UTSW 1 75406684 missense possibly damaging 0.94
R6505:Speg UTSW 1 75429523 missense possibly damaging 0.93
R6531:Speg UTSW 1 75422757 missense probably benign 0.03
R6566:Speg UTSW 1 75388463 missense probably damaging 1.00
R6747:Speg UTSW 1 75410395 critical splice donor site probably null
R6819:Speg UTSW 1 75391812 missense possibly damaging 0.56
R6821:Speg UTSW 1 75417903 missense possibly damaging 0.83
R6981:Speg UTSW 1 75430913 missense probably damaging 1.00
R7002:Speg UTSW 1 75423268 missense probably damaging 0.98
R7082:Speg UTSW 1 75411447 missense probably damaging 0.96
R7140:Speg UTSW 1 75406770 critical splice donor site probably null
R7175:Speg UTSW 1 75422490 missense probably benign 0.01
R7178:Speg UTSW 1 75422383 missense possibly damaging 0.46
X0025:Speg UTSW 1 75422457 missense probably damaging 1.00
X0026:Speg UTSW 1 75423475 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- CAATCCCTCTCACAAGCTAGGG -3'
(R):5'- TGTAGCTTGTCCAGGATGCG -3'

Sequencing Primer
(F):5'- TCTCACAAGCTAGGGGGTCTAG -3'
(R):5'- AATGCTGACAGGCGACC -3'
Posted On2018-11-06