Incidental Mutation 'R6919:Pgm1'
ID539489
Institutional Source Beutler Lab
Gene Symbol Pgm1
Ensembl Gene ENSMUSG00000029171
Gene Namephosphoglucomutase 1
SynonymsPgm-1, 3230402E02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6919 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location64092950-64128351 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 64097025 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 51 (N51I)
Ref Sequence ENSEMBL: ENSMUSP00000084582 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087324]
Predicted Effect probably benign
Transcript: ENSMUST00000087324
AA Change: N51I

PolyPhen 2 Score 0.113 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000084582
Gene: ENSMUSG00000029171
AA Change: N51I

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:PGM_PMM_I 62 211 7.8e-37 PFAM
Pfam:PGM_PMM_II 235 344 1.9e-25 PFAM
Pfam:PGM_PMM_III 351 480 4.6e-15 PFAM
Pfam:PGM_PMM_IV 523 603 5.5e-8 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.8%
Validation Efficiency 99% (84/85)
MGI Phenotype PHENOTYPE: Four electrophoretic variants are known, each with a 5-band pattern: the a allele in C57BL/6, BALB/c and AKR; b allele in DBA/2 and SJL; c allele in C3H/He; and d allele in 129/Re. Heterozygotes show a mixture of bands. Mice homozygous for a spontaneous null allele or ENU induced alleles are viable. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700086D15Rik A G 11: 65,152,530 probably benign Het
4931408C20Rik T C 1: 26,682,934 Y1055C probably benign Het
6430548M08Rik T C 8: 120,145,482 S50P probably damaging Het
Aacs A G 5: 125,506,163 D261G probably benign Het
Abcc4 T A 14: 118,594,894 T775S probably benign Het
Acsl6 A G 11: 54,341,756 probably null Het
Agbl5 T A 5: 30,904,717 F196I probably benign Het
Ahnak2 T C 12: 112,774,684 T985A possibly damaging Het
Ak1 A T 2: 32,631,122 D101V possibly damaging Het
Alx1 A G 10: 103,025,200 Y156H probably damaging Het
Angptl7 T A 4: 148,500,031 S87C probably benign Het
Ankrd36 A G 11: 5,629,299 T188A probably benign Het
Arhgap11a A C 2: 113,839,709 S356R possibly damaging Het
Ascc3 G T 10: 50,645,753 E455* probably null Het
Atp6v0a2 G A 5: 124,712,161 probably null Het
B3gnt7 T C 1: 86,305,694 W104R probably damaging Het
Bbs9 G A 9: 22,812,544 probably null Het
Cc2d2a T A 5: 43,703,215 D544E probably benign Het
Cic C T 7: 25,271,777 T311I probably benign Het
Cngb1 T A 8: 95,248,375 R1157W probably null Het
Cntln A G 4: 85,115,368 H1310R probably benign Het
Cntnap5c A T 17: 58,293,953 I764F probably benign Het
Col26a1 T C 5: 136,744,234 Q362R possibly damaging Het
Cyp2c29 G A 19: 39,291,141 R100K probably benign Het
D17H6S53E C G 17: 35,127,246 D44E probably damaging Het
Dap3 A G 3: 88,930,989 V65A probably damaging Het
Dna2 A T 10: 62,957,003 I266F probably damaging Het
Dnah14 G A 1: 181,585,066 G57E probably benign Het
Dock9 A T 14: 121,643,152 V333E probably benign Het
Dpm1 A G 2: 168,230,275 Y27H probably damaging Het
Dsp A T 13: 38,167,655 Y150F possibly damaging Het
Emilin3 A T 2: 160,908,098 I577N probably damaging Het
Erap1 A G 13: 74,671,433 T189A probably benign Het
Fam208a T A 14: 27,449,801 L397* probably null Het
Fat2 A G 11: 55,282,771 I2372T possibly damaging Het
Fbn2 A T 18: 58,124,187 probably null Het
Gnl1 A T 17: 35,987,533 R390* probably null Het
Hivep1 A G 13: 42,183,452 I2336V probably benign Het
Il17rb C G 14: 30,004,271 probably null Het
Itga9 T C 9: 118,887,815 W396R probably damaging Het
Katnal2 A G 18: 77,011,038 V152A probably benign Het
Kcnk3 A G 5: 30,622,400 T265A probably benign Het
Klhl1 T C 14: 96,136,594 Y672C probably benign Het
Leng8 C A 7: 4,143,626 N412K possibly damaging Het
Lrrc9 T A 12: 72,506,393 F1356L probably benign Het
Map7 A G 10: 20,171,082 probably benign Het
Mei1 T C 15: 82,081,930 F251S probably damaging Het
Mia2 A G 12: 59,129,895 E9G possibly damaging Het
Ms4a13 C A 19: 11,171,885 W182C probably benign Het
Muc16 C T 9: 18,660,299 R308K unknown Het
Olfr1195 G A 2: 88,683,684 T16I possibly damaging Het
Olfr936 A G 9: 39,047,531 probably benign Het
Pcnt A G 10: 76,385,798 V1998A probably benign Het
Piezo1 T A 8: 122,490,281 H1333L probably damaging Het
Prg2 G A 2: 84,983,256 V199M probably damaging Het
Prss51 T C 14: 64,097,488 V182A probably damaging Het
Psmb9 A T 17: 34,183,225 Y132* probably null Het
Ralyl T C 3: 13,777,031 Y76H probably damaging Het
Rnaset2a A T 17: 8,130,282 D174E probably benign Het
Rnft1 G A 11: 86,495,330 probably null Het
Robo2 T C 16: 73,961,867 Y676C probably damaging Het
Samd9l T G 6: 3,376,313 Y316S possibly damaging Het
Siah3 T A 14: 75,456,138 F28Y possibly damaging Het
Slc28a3 C T 13: 58,573,443 probably null Het
Slc8a1 A G 17: 81,388,872 F911S probably damaging Het
Speg T A 1: 75,387,908 L156* probably null Het
Spopl T G 2: 23,517,861 M269L probably benign Het
Tacr1 C T 6: 82,557,073 T360I probably benign Het
Tmem262 A G 19: 6,080,737 E95G probably benign Het
Tmem68 G T 4: 3,569,669 T7N possibly damaging Het
Top3a T A 11: 60,749,493 I460F probably damaging Het
Trafd1 G A 5: 121,384,074 R5* probably null Het
Trim16 T A 11: 62,840,869 V435D possibly damaging Het
Tspan17 A G 13: 54,796,033 D236G probably damaging Het
Tssk2 A T 16: 17,899,701 M323L probably benign Het
Ubqln5 A G 7: 104,129,008 V203A probably benign Het
Utrn A T 10: 12,693,470 L1134* probably null Het
Vmn1r37 C T 6: 66,731,720 S73F possibly damaging Het
Vps13c A G 9: 67,927,452 K1688E probably damaging Het
Zbtb39 A G 10: 127,741,842 D95G probably damaging Het
Zfhx3 T A 8: 108,800,528 I1019N probably damaging Het
Zfp207 C T 11: 80,395,503 probably benign Het
Zmiz1 C T 14: 25,643,638 T169M probably damaging Het
Other mutations in Pgm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00435:Pgm1 APN 5 64108269 splice site probably benign
IGL01068:Pgm1 APN 5 64107796 missense probably damaging 0.99
IGL01112:Pgm1 APN 5 64102882 missense possibly damaging 0.86
IGL01634:Pgm1 APN 5 64100974 missense probably benign 0.01
IGL02513:Pgm1 APN 5 64102946 unclassified probably benign
R0255:Pgm1 UTSW 5 64112043 missense possibly damaging 0.93
R0268:Pgm1 UTSW 5 64105808 missense probably damaging 1.00
R0511:Pgm1 UTSW 5 64110555 missense probably damaging 1.00
R0722:Pgm1 UTSW 5 64107679 nonsense probably null
R0881:Pgm1 UTSW 5 64093008 missense unknown
R0924:Pgm1 UTSW 5 64112147 missense possibly damaging 0.90
R0930:Pgm1 UTSW 5 64112147 missense possibly damaging 0.90
R1773:Pgm1 UTSW 5 64107851 critical splice donor site probably null
R1777:Pgm1 UTSW 5 64127782 missense probably benign
R2137:Pgm1 UTSW 5 64116366 missense probably benign
R2244:Pgm1 UTSW 5 64106702 missense probably benign 0.00
R3946:Pgm1 UTSW 5 64112061 missense probably benign
R4301:Pgm1 UTSW 5 64103797 nonsense probably null
R4601:Pgm1 UTSW 5 64107727 missense probably benign 0.02
R4631:Pgm1 UTSW 5 64105947 splice site probably null
R4795:Pgm1 UTSW 5 64103874 missense probably damaging 1.00
R4871:Pgm1 UTSW 5 64103894 missense probably benign
R4893:Pgm1 UTSW 5 64105940 missense probably benign
R4907:Pgm1 UTSW 5 64103878 missense probably benign 0.00
R4915:Pgm1 UTSW 5 64100948 missense probably damaging 1.00
R5092:Pgm1 UTSW 5 64107749 missense possibly damaging 0.49
R5197:Pgm1 UTSW 5 64105832 missense possibly damaging 0.87
R5621:Pgm1 UTSW 5 64112038 nonsense probably null
R6311:Pgm1 UTSW 5 64116415 missense probably benign 0.05
R6651:Pgm1 UTSW 5 64112094 missense probably benign 0.07
R6731:Pgm1 UTSW 5 64100975 missense probably benign 0.27
R6885:Pgm1 UTSW 5 64103878 missense probably benign 0.00
R7211:Pgm1 UTSW 5 64105850 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCAGGAAATGCAAAAGCCTCTG -3'
(R):5'- TATCAGGACTCAGGGAGATGC -3'

Sequencing Primer
(F):5'- GGAAATGCAAAAGCCTCTGTTTATAC -3'
(R):5'- GATGCCCCAGGAGTAACAGC -3'
Posted On2018-11-06