Incidental Mutation 'R6919:Itga9'
ID539507
Institutional Source Beutler Lab
Gene Symbol Itga9
Ensembl Gene ENSMUSG00000039115
Gene Nameintegrin alpha 9
SynonymsD9Ertd428e, 2610002H11Rik, 6720458D17Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6919 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location118606690-118901003 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 118887815 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 396 (W396R)
Ref Sequence ENSEMBL: ENSMUSP00000122417 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044165] [ENSMUST00000124360]
Predicted Effect probably damaging
Transcript: ENSMUST00000044165
AA Change: W982R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000044227
Gene: ENSMUSG00000039115
AA Change: W982R

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Int_alpha 45 105 8.95e-7 SMART
low complexity region 181 191 N/A INTRINSIC
Int_alpha 244 297 2.12e-8 SMART
Int_alpha 301 356 1.68e-11 SMART
Int_alpha 361 416 2.9e-15 SMART
Int_alpha 423 476 1.11e-2 SMART
SCOP:d1m1xa2 626 766 3e-32 SMART
SCOP:d1m1xa3 769 970 1e-39 SMART
transmembrane domain 981 1003 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000124360
AA Change: W396R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122417
Gene: ENSMUSG00000039115
AA Change: W396R

DomainStartEndE-ValueType
Pfam:Integrin_alpha2 1 357 2.1e-61 PFAM
transmembrane domain 395 417 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.8%
Validation Efficiency 99% (84/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an alpha integrin. Integrins are heterodimeric integral membrane glycoproteins composed of an alpha chain and a beta chain that mediate cell-cell and cell-matrix adhesion. The protein encoded by this gene, when bound to the beta 1 chain, forms an integrin that is a receptor for VCAM1, cytotactin and osteopontin. Expression of this gene has been found to be upregulated in small cell lung cancers. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in respiratory distress leading to postnatal lethality caused by an accumulation of pleural fluid rich in triglyceride, cholesterol and lymphocytes. Mice develop edema and lymphocytic infiltration in the chest wall. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700086D15Rik A G 11: 65,152,530 probably benign Het
4931408C20Rik T C 1: 26,682,934 Y1055C probably benign Het
6430548M08Rik T C 8: 120,145,482 S50P probably damaging Het
Aacs A G 5: 125,506,163 D261G probably benign Het
Abcc4 T A 14: 118,594,894 T775S probably benign Het
Acsl6 A G 11: 54,341,756 probably null Het
Agbl5 T A 5: 30,904,717 F196I probably benign Het
Ahnak2 T C 12: 112,774,684 T985A possibly damaging Het
Ak1 A T 2: 32,631,122 D101V possibly damaging Het
Alx1 A G 10: 103,025,200 Y156H probably damaging Het
Angptl7 T A 4: 148,500,031 S87C probably benign Het
Ankrd36 A G 11: 5,629,299 T188A probably benign Het
Arhgap11a A C 2: 113,839,709 S356R possibly damaging Het
Ascc3 G T 10: 50,645,753 E455* probably null Het
Atp6v0a2 G A 5: 124,712,161 probably null Het
B3gnt7 T C 1: 86,305,694 W104R probably damaging Het
Bbs9 G A 9: 22,812,544 probably null Het
Cc2d2a T A 5: 43,703,215 D544E probably benign Het
Cic C T 7: 25,271,777 T311I probably benign Het
Cngb1 T A 8: 95,248,375 R1157W probably null Het
Cntln A G 4: 85,115,368 H1310R probably benign Het
Cntnap5c A T 17: 58,293,953 I764F probably benign Het
Col26a1 T C 5: 136,744,234 Q362R possibly damaging Het
Cyp2c29 G A 19: 39,291,141 R100K probably benign Het
D17H6S53E C G 17: 35,127,246 D44E probably damaging Het
Dap3 A G 3: 88,930,989 V65A probably damaging Het
Dna2 A T 10: 62,957,003 I266F probably damaging Het
Dnah14 G A 1: 181,585,066 G57E probably benign Het
Dock9 A T 14: 121,643,152 V333E probably benign Het
Dpm1 A G 2: 168,230,275 Y27H probably damaging Het
Dsp A T 13: 38,167,655 Y150F possibly damaging Het
Emilin3 A T 2: 160,908,098 I577N probably damaging Het
Erap1 A G 13: 74,671,433 T189A probably benign Het
Fam208a T A 14: 27,449,801 L397* probably null Het
Fat2 A G 11: 55,282,771 I2372T possibly damaging Het
Fbn2 A T 18: 58,124,187 probably null Het
Gnl1 A T 17: 35,987,533 R390* probably null Het
Hivep1 A G 13: 42,183,452 I2336V probably benign Het
Il17rb C G 14: 30,004,271 probably null Het
Katnal2 A G 18: 77,011,038 V152A probably benign Het
Kcnk3 A G 5: 30,622,400 T265A probably benign Het
Klhl1 T C 14: 96,136,594 Y672C probably benign Het
Leng8 C A 7: 4,143,626 N412K possibly damaging Het
Lrrc9 T A 12: 72,506,393 F1356L probably benign Het
Map7 A G 10: 20,171,082 probably benign Het
Mei1 T C 15: 82,081,930 F251S probably damaging Het
Mia2 A G 12: 59,129,895 E9G possibly damaging Het
Ms4a13 C A 19: 11,171,885 W182C probably benign Het
Muc16 C T 9: 18,660,299 R308K unknown Het
Olfr1195 G A 2: 88,683,684 T16I possibly damaging Het
Olfr936 A G 9: 39,047,531 probably benign Het
Pcnt A G 10: 76,385,798 V1998A probably benign Het
Pgm1 A T 5: 64,097,025 N51I probably benign Het
Piezo1 T A 8: 122,490,281 H1333L probably damaging Het
Prg2 G A 2: 84,983,256 V199M probably damaging Het
Prss51 T C 14: 64,097,488 V182A probably damaging Het
Psmb9 A T 17: 34,183,225 Y132* probably null Het
Ralyl T C 3: 13,777,031 Y76H probably damaging Het
Rnaset2a A T 17: 8,130,282 D174E probably benign Het
Rnft1 G A 11: 86,495,330 probably null Het
Robo2 T C 16: 73,961,867 Y676C probably damaging Het
Samd9l T G 6: 3,376,313 Y316S possibly damaging Het
Siah3 T A 14: 75,456,138 F28Y possibly damaging Het
Slc28a3 C T 13: 58,573,443 probably null Het
Slc8a1 A G 17: 81,388,872 F911S probably damaging Het
Speg T A 1: 75,387,908 L156* probably null Het
Spopl T G 2: 23,517,861 M269L probably benign Het
Tacr1 C T 6: 82,557,073 T360I probably benign Het
Tmem262 A G 19: 6,080,737 E95G probably benign Het
Tmem68 G T 4: 3,569,669 T7N possibly damaging Het
Top3a T A 11: 60,749,493 I460F probably damaging Het
Trafd1 G A 5: 121,384,074 R5* probably null Het
Trim16 T A 11: 62,840,869 V435D possibly damaging Het
Tspan17 A G 13: 54,796,033 D236G probably damaging Het
Tssk2 A T 16: 17,899,701 M323L probably benign Het
Ubqln5 A G 7: 104,129,008 V203A probably benign Het
Utrn A T 10: 12,693,470 L1134* probably null Het
Vmn1r37 C T 6: 66,731,720 S73F possibly damaging Het
Vps13c A G 9: 67,927,452 K1688E probably damaging Het
Zbtb39 A G 10: 127,741,842 D95G probably damaging Het
Zfhx3 T A 8: 108,800,528 I1019N probably damaging Het
Zfp207 C T 11: 80,395,503 probably benign Het
Zmiz1 C T 14: 25,643,638 T169M probably damaging Het
Other mutations in Itga9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01310:Itga9 APN 9 118769159 start codon destroyed probably null 0.02
IGL01396:Itga9 APN 9 118607123 splice site probably benign
IGL01476:Itga9 APN 9 118607111 missense probably damaging 1.00
IGL01573:Itga9 APN 9 118877230 splice site probably benign
IGL01958:Itga9 APN 9 118636494 splice site probably benign
IGL02060:Itga9 APN 9 118661432 missense probably damaging 1.00
IGL02146:Itga9 APN 9 118834332 missense possibly damaging 0.50
IGL02391:Itga9 APN 9 118850805 missense probably benign 0.19
IGL02947:Itga9 APN 9 118658533 missense probably damaging 1.00
IGL03014:Itga9 UTSW 9 118628144 missense probably benign
R0052:Itga9 UTSW 9 118636549 missense probably damaging 1.00
R0052:Itga9 UTSW 9 118636549 missense probably damaging 1.00
R0142:Itga9 UTSW 9 118636586 missense probably damaging 0.96
R0179:Itga9 UTSW 9 118661386 missense probably benign 0.11
R0207:Itga9 UTSW 9 118769253 splice site probably benign
R0364:Itga9 UTSW 9 118841142 missense probably benign
R0458:Itga9 UTSW 9 118681028 critical splice donor site probably null
R1486:Itga9 UTSW 9 118626450 missense probably damaging 0.98
R1589:Itga9 UTSW 9 118607117 critical splice donor site probably null
R1620:Itga9 UTSW 9 118843502 missense probably benign 0.00
R1711:Itga9 UTSW 9 118698461 missense probably benign 0.00
R1721:Itga9 UTSW 9 118698306 splice site probably benign
R2064:Itga9 UTSW 9 118807293 missense probably damaging 0.99
R2201:Itga9 UTSW 9 118877115 splice site probably benign
R2851:Itga9 UTSW 9 118636536 missense probably damaging 0.98
R2853:Itga9 UTSW 9 118636536 missense probably damaging 0.98
R3962:Itga9 UTSW 9 118628186 missense possibly damaging 0.57
R4180:Itga9 UTSW 9 118607078 missense probably damaging 1.00
R4597:Itga9 UTSW 9 118843514 missense probably damaging 1.00
R4716:Itga9 UTSW 9 118681758 missense probably damaging 0.98
R4929:Itga9 UTSW 9 118807249 missense probably damaging 1.00
R5002:Itga9 UTSW 9 118663898 nonsense probably null
R5279:Itga9 UTSW 9 118628205 missense probably damaging 1.00
R5542:Itga9 UTSW 9 118843661 missense possibly damaging 0.86
R5869:Itga9 UTSW 9 118663889 missense probably damaging 1.00
R6372:Itga9 UTSW 9 118897321 missense probably damaging 1.00
R6470:Itga9 UTSW 9 118897267 missense probably damaging 0.99
R6581:Itga9 UTSW 9 118658564 missense probably benign 0.00
R7034:Itga9 UTSW 9 118698365 missense probably benign 0.00
R7036:Itga9 UTSW 9 118698365 missense probably benign 0.00
R7043:Itga9 UTSW 9 118769116 missense probably damaging 0.96
R7237:Itga9 UTSW 9 118636602 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- AGAACCCCAGCGTTCTTTC -3'
(R):5'- ACTGTGCAGGGAAACATCTCC -3'

Sequencing Primer
(F):5'- TCTTTCAGAGCCGAATGCAAG -3'
(R):5'- GGAAACATCTCCCAAGGTTCC -3'
Posted On2018-11-06