Incidental Mutation 'R6919:Alx1'
ID539512
Institutional Source Beutler Lab
Gene Symbol Alx1
Ensembl Gene ENSMUSG00000036602
Gene NameALX homeobox 1
SynonymsCart1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6919 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location102998707-103030215 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 103025200 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 156 (Y156H)
Ref Sequence ENSEMBL: ENSMUSP00000151728 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040859] [ENSMUST00000167156] [ENSMUST00000217946] [ENSMUST00000218282] [ENSMUST00000218681] [ENSMUST00000219194]
Predicted Effect probably damaging
Transcript: ENSMUST00000040859
AA Change: Y156H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000042512
Gene: ENSMUSG00000036602
AA Change: Y156H

DomainStartEndE-ValueType
HOX 132 194 1.84e-25 SMART
Pfam:OAR 301 321 7.3e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000167156
AA Change: Y156H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000129230
Gene: ENSMUSG00000036602
AA Change: Y156H

DomainStartEndE-ValueType
HOX 132 194 1.84e-25 SMART
Pfam:OAR 302 320 2.3e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000217946
AA Change: Y156H

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000218282
AA Change: Y156H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000218681
AA Change: Y156H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000219194
AA Change: Y156H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.4 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.8%
Validation Efficiency 99% (84/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The specific function of this gene has yet to be determined in humans; however, in rodents, it is necessary for survival of the forebrain mesenchyme and may also be involved in development of the cervix. Mutations in the mouse gene lead to neural tube defects such as acrania and meroanencephaly. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice exhibit perinatal lethality with acrania and meroanencephaly, but the neural tube closure defect can be ameliorated with prenatal folic acid treatment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700086D15Rik A G 11: 65,152,530 probably benign Het
4931408C20Rik T C 1: 26,682,934 Y1055C probably benign Het
6430548M08Rik T C 8: 120,145,482 S50P probably damaging Het
Aacs A G 5: 125,506,163 D261G probably benign Het
Abcc4 T A 14: 118,594,894 T775S probably benign Het
Acsl6 A G 11: 54,341,756 probably null Het
Agbl5 T A 5: 30,904,717 F196I probably benign Het
Ahnak2 T C 12: 112,774,684 T985A possibly damaging Het
Ak1 A T 2: 32,631,122 D101V possibly damaging Het
Angptl7 T A 4: 148,500,031 S87C probably benign Het
Ankrd36 A G 11: 5,629,299 T188A probably benign Het
Arhgap11a A C 2: 113,839,709 S356R possibly damaging Het
Ascc3 G T 10: 50,645,753 E455* probably null Het
Atp6v0a2 G A 5: 124,712,161 probably null Het
B3gnt7 T C 1: 86,305,694 W104R probably damaging Het
Bbs9 G A 9: 22,812,544 probably null Het
Cc2d2a T A 5: 43,703,215 D544E probably benign Het
Cic C T 7: 25,271,777 T311I probably benign Het
Cngb1 T A 8: 95,248,375 R1157W probably null Het
Cntln A G 4: 85,115,368 H1310R probably benign Het
Cntnap5c A T 17: 58,293,953 I764F probably benign Het
Col26a1 T C 5: 136,744,234 Q362R possibly damaging Het
Cyp2c29 G A 19: 39,291,141 R100K probably benign Het
D17H6S53E C G 17: 35,127,246 D44E probably damaging Het
Dap3 A G 3: 88,930,989 V65A probably damaging Het
Dna2 A T 10: 62,957,003 I266F probably damaging Het
Dnah14 G A 1: 181,585,066 G57E probably benign Het
Dock9 A T 14: 121,643,152 V333E probably benign Het
Dpm1 A G 2: 168,230,275 Y27H probably damaging Het
Dsp A T 13: 38,167,655 Y150F possibly damaging Het
Emilin3 A T 2: 160,908,098 I577N probably damaging Het
Erap1 A G 13: 74,671,433 T189A probably benign Het
Fam208a T A 14: 27,449,801 L397* probably null Het
Fat2 A G 11: 55,282,771 I2372T possibly damaging Het
Fbn2 A T 18: 58,124,187 probably null Het
Gnl1 A T 17: 35,987,533 R390* probably null Het
Hivep1 A G 13: 42,183,452 I2336V probably benign Het
Il17rb C G 14: 30,004,271 probably null Het
Itga9 T C 9: 118,887,815 W396R probably damaging Het
Katnal2 A G 18: 77,011,038 V152A probably benign Het
Kcnk3 A G 5: 30,622,400 T265A probably benign Het
Klhl1 T C 14: 96,136,594 Y672C probably benign Het
Leng8 C A 7: 4,143,626 N412K possibly damaging Het
Lrrc9 T A 12: 72,506,393 F1356L probably benign Het
Map7 A G 10: 20,171,082 probably benign Het
Mei1 T C 15: 82,081,930 F251S probably damaging Het
Mia2 A G 12: 59,129,895 E9G possibly damaging Het
Ms4a13 C A 19: 11,171,885 W182C probably benign Het
Muc16 C T 9: 18,660,299 R308K unknown Het
Olfr1195 G A 2: 88,683,684 T16I possibly damaging Het
Olfr936 A G 9: 39,047,531 probably benign Het
Pcnt A G 10: 76,385,798 V1998A probably benign Het
Pgm1 A T 5: 64,097,025 N51I probably benign Het
Piezo1 T A 8: 122,490,281 H1333L probably damaging Het
Prg2 G A 2: 84,983,256 V199M probably damaging Het
Prss51 T C 14: 64,097,488 V182A probably damaging Het
Psmb9 A T 17: 34,183,225 Y132* probably null Het
Ralyl T C 3: 13,777,031 Y76H probably damaging Het
Rnaset2a A T 17: 8,130,282 D174E probably benign Het
Rnft1 G A 11: 86,495,330 probably null Het
Robo2 T C 16: 73,961,867 Y676C probably damaging Het
Samd9l T G 6: 3,376,313 Y316S possibly damaging Het
Siah3 T A 14: 75,456,138 F28Y possibly damaging Het
Slc28a3 C T 13: 58,573,443 probably null Het
Slc8a1 A G 17: 81,388,872 F911S probably damaging Het
Speg T A 1: 75,387,908 L156* probably null Het
Spopl T G 2: 23,517,861 M269L probably benign Het
Tacr1 C T 6: 82,557,073 T360I probably benign Het
Tmem262 A G 19: 6,080,737 E95G probably benign Het
Tmem68 G T 4: 3,569,669 T7N possibly damaging Het
Top3a T A 11: 60,749,493 I460F probably damaging Het
Trafd1 G A 5: 121,384,074 R5* probably null Het
Trim16 T A 11: 62,840,869 V435D possibly damaging Het
Tspan17 A G 13: 54,796,033 D236G probably damaging Het
Tssk2 A T 16: 17,899,701 M323L probably benign Het
Ubqln5 A G 7: 104,129,008 V203A probably benign Het
Utrn A T 10: 12,693,470 L1134* probably null Het
Vmn1r37 C T 6: 66,731,720 S73F possibly damaging Het
Vps13c A G 9: 67,927,452 K1688E probably damaging Het
Zbtb39 A G 10: 127,741,842 D95G probably damaging Het
Zfhx3 T A 8: 108,800,528 I1019N probably damaging Het
Zfp207 C T 11: 80,395,503 probably benign Het
Zmiz1 C T 14: 25,643,638 T169M probably damaging Het
Other mutations in Alx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02331:Alx1 APN 10 103022299 missense possibly damaging 0.93
IGL02508:Alx1 APN 10 103022193 missense probably damaging 0.99
IGL03079:Alx1 APN 10 103009348 missense probably damaging 1.00
R1345:Alx1 UTSW 10 103028492 missense possibly damaging 0.86
R1370:Alx1 UTSW 10 103028492 missense possibly damaging 0.86
R1846:Alx1 UTSW 10 103025304 missense possibly damaging 0.88
R1912:Alx1 UTSW 10 103025361 missense probably damaging 1.00
R4649:Alx1 UTSW 10 103009332 missense probably damaging 0.99
R4767:Alx1 UTSW 10 103025186 nonsense probably null
R5484:Alx1 UTSW 10 103025316 missense probably damaging 0.99
R5979:Alx1 UTSW 10 103022259 missense probably damaging 1.00
R6115:Alx1 UTSW 10 103028443 missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- GGCCAATTTCCTCACATGTTAC -3'
(R):5'- CTTCACACCGAGCTGAATAGAGC -3'

Sequencing Primer
(F):5'- GCCAATTTCCTCACATGTTACTTTGG -3'
(R):5'- AATGGATAACTGCAACAATCTCAGG -3'
Posted On2018-11-06