Incidental Mutation 'R6919:Ankrd36'
ID539514
Institutional Source Beutler Lab
Gene Symbol Ankrd36
Ensembl Gene ENSMUSG00000020481
Gene Nameankyrin repeat domain 36
Synonyms1700012M14Rik, 1700008J08Rik, GC3
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R6919 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location5569684-5689337 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 5629299 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 188 (T188A)
Ref Sequence ENSEMBL: ENSMUSP00000120499 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109856] [ENSMUST00000118112] [ENSMUST00000137933]
Predicted Effect probably benign
Transcript: ENSMUST00000109856
AA Change: T831A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000105482
Gene: ENSMUSG00000020481
AA Change: T831A

DomainStartEndE-ValueType
Blast:ANK 29 62 3e-12 BLAST
ANK 66 95 4.5e-3 SMART
ANK 99 128 1.44e-1 SMART
ANK 132 161 4.6e0 SMART
ANK 165 194 2.48e-5 SMART
ANK 198 227 4.67e-1 SMART
internal_repeat_1 449 555 1.04e-5 PROSPERO
internal_repeat_1 891 981 1.04e-5 PROSPERO
low complexity region 1105 1118 N/A INTRINSIC
coiled coil region 1268 1297 N/A INTRINSIC
coiled coil region 1318 1338 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118112
AA Change: T863A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000122397
Gene: ENSMUSG00000020481
AA Change: T863A

DomainStartEndE-ValueType
Blast:ANK 29 62 3e-12 BLAST
ANK 66 95 2.9e-5 SMART
ANK 99 128 9.4e-4 SMART
ANK 132 161 2.9e-2 SMART
ANK 165 194 1.5e-7 SMART
ANK 198 227 2.9e-3 SMART
internal_repeat_1 255 352 8.15e-5 PROSPERO
internal_repeat_1 438 538 8.15e-5 PROSPERO
low complexity region 1138 1151 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137933
AA Change: T188A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000120499
Gene: ENSMUSG00000020481
AA Change: T188A

DomainStartEndE-ValueType
low complexity region 463 476 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.8%
Validation Efficiency 99% (84/85)
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700086D15Rik A G 11: 65,152,530 probably benign Het
4931408C20Rik T C 1: 26,682,934 Y1055C probably benign Het
6430548M08Rik T C 8: 120,145,482 S50P probably damaging Het
Aacs A G 5: 125,506,163 D261G probably benign Het
Abcc4 T A 14: 118,594,894 T775S probably benign Het
Acsl6 A G 11: 54,341,756 probably null Het
Agbl5 T A 5: 30,904,717 F196I probably benign Het
Ahnak2 T C 12: 112,774,684 T985A possibly damaging Het
Ak1 A T 2: 32,631,122 D101V possibly damaging Het
Alx1 A G 10: 103,025,200 Y156H probably damaging Het
Angptl7 T A 4: 148,500,031 S87C probably benign Het
Arhgap11a A C 2: 113,839,709 S356R possibly damaging Het
Ascc3 G T 10: 50,645,753 E455* probably null Het
Atp6v0a2 G A 5: 124,712,161 probably null Het
B3gnt7 T C 1: 86,305,694 W104R probably damaging Het
Bbs9 G A 9: 22,812,544 probably null Het
Cc2d2a T A 5: 43,703,215 D544E probably benign Het
Cic C T 7: 25,271,777 T311I probably benign Het
Cngb1 T A 8: 95,248,375 R1157W probably null Het
Cntln A G 4: 85,115,368 H1310R probably benign Het
Cntnap5c A T 17: 58,293,953 I764F probably benign Het
Col26a1 T C 5: 136,744,234 Q362R possibly damaging Het
Cyp2c29 G A 19: 39,291,141 R100K probably benign Het
D17H6S53E C G 17: 35,127,246 D44E probably damaging Het
Dap3 A G 3: 88,930,989 V65A probably damaging Het
Dna2 A T 10: 62,957,003 I266F probably damaging Het
Dnah14 G A 1: 181,585,066 G57E probably benign Het
Dock9 A T 14: 121,643,152 V333E probably benign Het
Dpm1 A G 2: 168,230,275 Y27H probably damaging Het
Dsp A T 13: 38,167,655 Y150F possibly damaging Het
Emilin3 A T 2: 160,908,098 I577N probably damaging Het
Erap1 A G 13: 74,671,433 T189A probably benign Het
Fam208a T A 14: 27,449,801 L397* probably null Het
Fat2 A G 11: 55,282,771 I2372T possibly damaging Het
Fbn2 A T 18: 58,124,187 probably null Het
Gnl1 A T 17: 35,987,533 R390* probably null Het
Hivep1 A G 13: 42,183,452 I2336V probably benign Het
Il17rb C G 14: 30,004,271 probably null Het
Itga9 T C 9: 118,887,815 W396R probably damaging Het
Katnal2 A G 18: 77,011,038 V152A probably benign Het
Kcnk3 A G 5: 30,622,400 T265A probably benign Het
Klhl1 T C 14: 96,136,594 Y672C probably benign Het
Leng8 C A 7: 4,143,626 N412K possibly damaging Het
Lrrc9 T A 12: 72,506,393 F1356L probably benign Het
Map7 A G 10: 20,171,082 probably benign Het
Mei1 T C 15: 82,081,930 F251S probably damaging Het
Mia2 A G 12: 59,129,895 E9G possibly damaging Het
Ms4a13 C A 19: 11,171,885 W182C probably benign Het
Muc16 C T 9: 18,660,299 R308K unknown Het
Olfr1195 G A 2: 88,683,684 T16I possibly damaging Het
Olfr936 A G 9: 39,047,531 probably benign Het
Pcnt A G 10: 76,385,798 V1998A probably benign Het
Pgm1 A T 5: 64,097,025 N51I probably benign Het
Piezo1 T A 8: 122,490,281 H1333L probably damaging Het
Prg2 G A 2: 84,983,256 V199M probably damaging Het
Prss51 T C 14: 64,097,488 V182A probably damaging Het
Psmb9 A T 17: 34,183,225 Y132* probably null Het
Ralyl T C 3: 13,777,031 Y76H probably damaging Het
Rnaset2a A T 17: 8,130,282 D174E probably benign Het
Rnft1 G A 11: 86,495,330 probably null Het
Robo2 T C 16: 73,961,867 Y676C probably damaging Het
Samd9l T G 6: 3,376,313 Y316S possibly damaging Het
Siah3 T A 14: 75,456,138 F28Y possibly damaging Het
Slc28a3 C T 13: 58,573,443 probably null Het
Slc8a1 A G 17: 81,388,872 F911S probably damaging Het
Speg T A 1: 75,387,908 L156* probably null Het
Spopl T G 2: 23,517,861 M269L probably benign Het
Tacr1 C T 6: 82,557,073 T360I probably benign Het
Tmem262 A G 19: 6,080,737 E95G probably benign Het
Tmem68 G T 4: 3,569,669 T7N possibly damaging Het
Top3a T A 11: 60,749,493 I460F probably damaging Het
Trafd1 G A 5: 121,384,074 R5* probably null Het
Trim16 T A 11: 62,840,869 V435D possibly damaging Het
Tspan17 A G 13: 54,796,033 D236G probably damaging Het
Tssk2 A T 16: 17,899,701 M323L probably benign Het
Ubqln5 A G 7: 104,129,008 V203A probably benign Het
Utrn A T 10: 12,693,470 L1134* probably null Het
Vmn1r37 C T 6: 66,731,720 S73F possibly damaging Het
Vps13c A G 9: 67,927,452 K1688E probably damaging Het
Zbtb39 A G 10: 127,741,842 D95G probably damaging Het
Zfhx3 T A 8: 108,800,528 I1019N probably damaging Het
Zfp207 C T 11: 80,395,503 probably benign Het
Zmiz1 C T 14: 25,643,638 T169M probably damaging Het
Other mutations in Ankrd36
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Ankrd36 APN 11 5620131 missense probably benign 0.01
IGL01361:Ankrd36 APN 11 5596706 splice site probably benign
IGL01370:Ankrd36 APN 11 5584019 missense probably benign 0.06
IGL01384:Ankrd36 APN 11 5628348 missense probably benign 0.33
IGL01484:Ankrd36 APN 11 5629006 missense possibly damaging 0.90
IGL01524:Ankrd36 APN 11 5635092 missense probably benign
IGL01700:Ankrd36 APN 11 5632198 missense probably benign 0.05
IGL02322:Ankrd36 APN 11 5614619 missense possibly damaging 0.86
IGL02511:Ankrd36 APN 11 5660845 unclassified probably null
IGL02824:Ankrd36 APN 11 5574246 missense possibly damaging 0.67
IGL03204:Ankrd36 APN 11 5584023 missense possibly damaging 0.70
PIT4508001:Ankrd36 UTSW 11 5607137 missense possibly damaging 0.53
R0058:Ankrd36 UTSW 11 5630691 splice site probably benign
R0058:Ankrd36 UTSW 11 5630691 splice site probably benign
R0304:Ankrd36 UTSW 11 5628981 missense possibly damaging 0.55
R0504:Ankrd36 UTSW 11 5629274 missense probably damaging 0.99
R0550:Ankrd36 UTSW 11 5607429 critical splice donor site probably null
R0563:Ankrd36 UTSW 11 5629322 missense probably benign 0.33
R0891:Ankrd36 UTSW 11 5687316 missense possibly damaging 0.72
R1018:Ankrd36 UTSW 11 5646876 unclassified probably benign
R1468:Ankrd36 UTSW 11 5575752 missense probably damaging 0.99
R1468:Ankrd36 UTSW 11 5575752 missense probably damaging 0.99
R1558:Ankrd36 UTSW 11 5635329 missense probably damaging 0.99
R1663:Ankrd36 UTSW 11 5620126 missense possibly damaging 0.70
R1682:Ankrd36 UTSW 11 5607143 missense possibly damaging 0.84
R1898:Ankrd36 UTSW 11 5575683 missense probably benign 0.33
R2019:Ankrd36 UTSW 11 5689140 missense probably benign
R2032:Ankrd36 UTSW 11 5628616 missense possibly damaging 0.86
R2084:Ankrd36 UTSW 11 5662378 nonsense probably null
R4097:Ankrd36 UTSW 11 5628703 missense possibly damaging 0.85
R4572:Ankrd36 UTSW 11 5689340 unclassified probably null
R4601:Ankrd36 UTSW 11 5570102 missense probably benign 0.04
R4770:Ankrd36 UTSW 11 5590870 missense possibly damaging 0.73
R4777:Ankrd36 UTSW 11 5607120 missense probably benign
R4894:Ankrd36 UTSW 11 5635332 missense probably damaging 0.98
R5288:Ankrd36 UTSW 11 5689340 unclassified probably benign
R5366:Ankrd36 UTSW 11 5592841 nonsense probably null
R5384:Ankrd36 UTSW 11 5689340 unclassified probably benign
R5385:Ankrd36 UTSW 11 5689340 unclassified probably benign
R6109:Ankrd36 UTSW 11 5628941 missense probably damaging 0.98
R6155:Ankrd36 UTSW 11 5687442 missense probably benign 0.00
R6186:Ankrd36 UTSW 11 5643812 missense possibly damaging 0.81
R6289:Ankrd36 UTSW 11 5628837 missense probably damaging 0.96
R6476:Ankrd36 UTSW 11 5628753 missense probably benign 0.05
R6816:Ankrd36 UTSW 11 5643765 missense possibly damaging 0.66
R6880:Ankrd36 UTSW 11 5628748 missense probably damaging 0.99
R7007:Ankrd36 UTSW 11 5689168 missense probably benign 0.00
U24488:Ankrd36 UTSW 11 5630772 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GAAGTCCAGTGATGCCAACAG -3'
(R):5'- ACACACCTCTATTTGCTTAGGG -3'

Sequencing Primer
(F):5'- TTTCAAACGCCAAAGAAAGGAGTC -3'
(R):5'- CTCTATTTGCTTAGGGGAAAAGAC -3'
Posted On2018-11-06