Incidental Mutation 'R6919:Erap1'
ID539529
Institutional Source Beutler Lab
Gene Symbol Erap1
Ensembl Gene ENSMUSG00000021583
Gene Nameendoplasmic reticulum aminopeptidase 1
SynonymsERAAP, Arts1, PILSAP
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.257) question?
Stock #R6919 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location74639568-74693201 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 74671433 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 189 (T189A)
Ref Sequence ENSEMBL: ENSMUSP00000152076 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169114] [ENSMUST00000222127]
Predicted Effect probably benign
Transcript: ENSMUST00000169114
AA Change: T618A

PolyPhen 2 Score 0.200 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000133166
Gene: ENSMUSG00000021583
AA Change: T618A

DomainStartEndE-ValueType
Pfam:Peptidase_M1 42 430 2.7e-135 PFAM
low complexity region 488 501 N/A INTRINSIC
Pfam:ERAP1_C 586 904 1.7e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000222127
AA Change: T189A

PolyPhen 2 Score 0.200 (Sensitivity: 0.92; Specificity: 0.88)
Meta Mutation Damage Score 0.142 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.8%
Validation Efficiency 99% (84/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an aminopeptidase involved in trimming HLA class I-binding precursors so that they can be presented on MHC class I molecules. The encoded protein acts as a monomer or as a heterodimer with ERAP2. This protein may also be involved in blood pressure regulation by inactivation of angiotensin II. Three transcript variants encoding two different isoforms have been found for this gene.[provided by RefSeq, Oct 2010]
PHENOTYPE: Mice homozygous for a targeted mutation may exhibit extramedullary hematopoiesis of the spleen, thymus hyperplasia, or enlarged kidneys at older ages. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700086D15Rik A G 11: 65,152,530 probably benign Het
4931408C20Rik T C 1: 26,682,934 Y1055C probably benign Het
6430548M08Rik T C 8: 120,145,482 S50P probably damaging Het
Aacs A G 5: 125,506,163 D261G probably benign Het
Abcc4 T A 14: 118,594,894 T775S probably benign Het
Acsl6 A G 11: 54,341,756 probably null Het
Agbl5 T A 5: 30,904,717 F196I probably benign Het
Ahnak2 T C 12: 112,774,684 T985A possibly damaging Het
Ak1 A T 2: 32,631,122 D101V possibly damaging Het
Alx1 A G 10: 103,025,200 Y156H probably damaging Het
Angptl7 T A 4: 148,500,031 S87C probably benign Het
Ankrd36 A G 11: 5,629,299 T188A probably benign Het
Arhgap11a A C 2: 113,839,709 S356R possibly damaging Het
Ascc3 G T 10: 50,645,753 E455* probably null Het
Atp6v0a2 G A 5: 124,712,161 probably null Het
B3gnt7 T C 1: 86,305,694 W104R probably damaging Het
Bbs9 G A 9: 22,812,544 probably null Het
Cc2d2a T A 5: 43,703,215 D544E probably benign Het
Cic C T 7: 25,271,777 T311I probably benign Het
Cngb1 T A 8: 95,248,375 R1157W probably null Het
Cntln A G 4: 85,115,368 H1310R probably benign Het
Cntnap5c A T 17: 58,293,953 I764F probably benign Het
Col26a1 T C 5: 136,744,234 Q362R possibly damaging Het
Cyp2c29 G A 19: 39,291,141 R100K probably benign Het
D17H6S53E C G 17: 35,127,246 D44E probably damaging Het
Dap3 A G 3: 88,930,989 V65A probably damaging Het
Dna2 A T 10: 62,957,003 I266F probably damaging Het
Dnah14 G A 1: 181,585,066 G57E probably benign Het
Dock9 A T 14: 121,643,152 V333E probably benign Het
Dpm1 A G 2: 168,230,275 Y27H probably damaging Het
Dsp A T 13: 38,167,655 Y150F possibly damaging Het
Emilin3 A T 2: 160,908,098 I577N probably damaging Het
Fam208a T A 14: 27,449,801 L397* probably null Het
Fat2 A G 11: 55,282,771 I2372T possibly damaging Het
Fbn2 A T 18: 58,124,187 probably null Het
Gnl1 A T 17: 35,987,533 R390* probably null Het
Hivep1 A G 13: 42,183,452 I2336V probably benign Het
Il17rb C G 14: 30,004,271 probably null Het
Itga9 T C 9: 118,887,815 W396R probably damaging Het
Katnal2 A G 18: 77,011,038 V152A probably benign Het
Kcnk3 A G 5: 30,622,400 T265A probably benign Het
Klhl1 T C 14: 96,136,594 Y672C probably benign Het
Leng8 C A 7: 4,143,626 N412K possibly damaging Het
Lrrc9 T A 12: 72,506,393 F1356L probably benign Het
Map7 A G 10: 20,171,082 probably benign Het
Mei1 T C 15: 82,081,930 F251S probably damaging Het
Mia2 A G 12: 59,129,895 E9G possibly damaging Het
Ms4a13 C A 19: 11,171,885 W182C probably benign Het
Muc16 C T 9: 18,660,299 R308K unknown Het
Olfr1195 G A 2: 88,683,684 T16I possibly damaging Het
Olfr936 A G 9: 39,047,531 probably benign Het
Pcnt A G 10: 76,385,798 V1998A probably benign Het
Pgm1 A T 5: 64,097,025 N51I probably benign Het
Piezo1 T A 8: 122,490,281 H1333L probably damaging Het
Prg2 G A 2: 84,983,256 V199M probably damaging Het
Prss51 T C 14: 64,097,488 V182A probably damaging Het
Psmb9 A T 17: 34,183,225 Y132* probably null Het
Ralyl T C 3: 13,777,031 Y76H probably damaging Het
Rnaset2a A T 17: 8,130,282 D174E probably benign Het
Rnft1 G A 11: 86,495,330 probably null Het
Robo2 T C 16: 73,961,867 Y676C probably damaging Het
Samd9l T G 6: 3,376,313 Y316S possibly damaging Het
Siah3 T A 14: 75,456,138 F28Y possibly damaging Het
Slc28a3 C T 13: 58,573,443 probably null Het
Slc8a1 A G 17: 81,388,872 F911S probably damaging Het
Speg T A 1: 75,387,908 L156* probably null Het
Spopl T G 2: 23,517,861 M269L probably benign Het
Tacr1 C T 6: 82,557,073 T360I probably benign Het
Tmem262 A G 19: 6,080,737 E95G probably benign Het
Tmem68 G T 4: 3,569,669 T7N possibly damaging Het
Top3a T A 11: 60,749,493 I460F probably damaging Het
Trafd1 G A 5: 121,384,074 R5* probably null Het
Trim16 T A 11: 62,840,869 V435D possibly damaging Het
Tspan17 A G 13: 54,796,033 D236G probably damaging Het
Tssk2 A T 16: 17,899,701 M323L probably benign Het
Ubqln5 A G 7: 104,129,008 V203A probably benign Het
Utrn A T 10: 12,693,470 L1134* probably null Het
Vmn1r37 C T 6: 66,731,720 S73F possibly damaging Het
Vps13c A G 9: 67,927,452 K1688E probably damaging Het
Zbtb39 A G 10: 127,741,842 D95G probably damaging Het
Zfhx3 T A 8: 108,800,528 I1019N probably damaging Het
Zfp207 C T 11: 80,395,503 probably benign Het
Zmiz1 C T 14: 25,643,638 T169M probably damaging Het
Other mutations in Erap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00432:Erap1 APN 13 74673659 missense probably benign 0.17
IGL00661:Erap1 APN 13 74674789 unclassified probably benign
IGL00903:Erap1 APN 13 74673707 missense probably benign
IGL01095:Erap1 APN 13 74668094 missense probably benign 0.04
IGL01536:Erap1 APN 13 74662423 nonsense probably null
IGL01646:Erap1 APN 13 74666172 missense probably damaging 1.00
IGL01674:Erap1 APN 13 74664231 unclassified probably benign
IGL01795:Erap1 APN 13 74666090 unclassified probably null
IGL01922:Erap1 APN 13 74662387 missense probably damaging 1.00
IGL01951:Erap1 APN 13 74675295 missense probably damaging 0.99
IGL02106:Erap1 APN 13 74646639 missense probably benign
IGL02369:Erap1 APN 13 74666526 missense probably benign 0.05
IGL02669:Erap1 APN 13 74675868 missense probably benign 0.13
IGL02866:Erap1 APN 13 74667999 missense probably damaging 0.96
IGL03093:Erap1 APN 13 74675280 missense probably benign 0.10
IGL03265:Erap1 APN 13 74664127 missense probably damaging 1.00
R0091:Erap1 UTSW 13 74668052 missense possibly damaging 0.88
R0456:Erap1 UTSW 13 74664220 missense probably benign 0.24
R0556:Erap1 UTSW 13 74660325 missense probably damaging 1.00
R0627:Erap1 UTSW 13 74675814 unclassified probably benign
R0825:Erap1 UTSW 13 74674614 unclassified probably benign
R1123:Erap1 UTSW 13 74673643 missense probably benign
R1530:Erap1 UTSW 13 74646543 missense probably benign 0.06
R1619:Erap1 UTSW 13 74671381 missense probably damaging 1.00
R1731:Erap1 UTSW 13 74666122 nonsense probably null
R1944:Erap1 UTSW 13 74646639 missense probably benign
R2016:Erap1 UTSW 13 74664151 missense probably damaging 1.00
R2022:Erap1 UTSW 13 74666508 missense probably benign 0.08
R2023:Erap1 UTSW 13 74666508 missense probably benign 0.08
R2045:Erap1 UTSW 13 74669450 missense probably benign 0.01
R2081:Erap1 UTSW 13 74675307 missense possibly damaging 0.67
R2187:Erap1 UTSW 13 74662405 missense probably damaging 0.98
R2198:Erap1 UTSW 13 74646687 missense probably damaging 0.97
R3938:Erap1 UTSW 13 74668028 missense probably damaging 1.00
R4052:Erap1 UTSW 13 74675340 missense probably benign 0.13
R4062:Erap1 UTSW 13 74663536 missense probably benign 0.02
R4128:Erap1 UTSW 13 74666196 missense probably damaging 1.00
R4247:Erap1 UTSW 13 74675295 missense probably damaging 0.99
R4562:Erap1 UTSW 13 74673659 missense probably benign 0.21
R4691:Erap1 UTSW 13 74673692 missense probably damaging 0.99
R4831:Erap1 UTSW 13 74690647 missense probably damaging 1.00
R4916:Erap1 UTSW 13 74646528 missense probably benign
R4983:Erap1 UTSW 13 74690710 missense probably benign 0.01
R5213:Erap1 UTSW 13 74671495 splice site probably null
R5229:Erap1 UTSW 13 74660375 missense possibly damaging 0.94
R5367:Erap1 UTSW 13 74646561 missense probably damaging 0.99
R5463:Erap1 UTSW 13 74646414 missense probably damaging 1.00
R5566:Erap1 UTSW 13 74662412 missense probably damaging 1.00
R5972:Erap1 UTSW 13 74662304 splice site probably null
R6112:Erap1 UTSW 13 74646279 missense probably benign 0.44
R6132:Erap1 UTSW 13 74660282 missense probably benign 0.00
R6180:Erap1 UTSW 13 74666226 missense possibly damaging 0.55
R6314:Erap1 UTSW 13 74674775 missense probably damaging 0.99
R6479:Erap1 UTSW 13 74663493 unclassified probably null
R7199:Erap1 UTSW 13 74666139 missense probably benign 0.10
X0067:Erap1 UTSW 13 74660372 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCATCCCCAGAGTAGATGG -3'
(R):5'- TGAAAGCTATGTTCCCTGTTGG -3'

Sequencing Primer
(F):5'- CATCCCCAGAGTAGATGGTTCTAAG -3'
(R):5'- AGAGGGGATGCCTTTCCAGATTC -3'
Posted On2018-11-06