Incidental Mutation 'R6919:Klhl1'
ID539534
Institutional Source Beutler Lab
Gene Symbol Klhl1
Ensembl Gene ENSMUSG00000022076
Gene Namekelch-like 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.189) question?
Stock #R6919 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location96102736-96519102 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 96136594 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 672 (Y672C)
Ref Sequence ENSEMBL: ENSMUSP00000022666 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022666]
Predicted Effect probably benign
Transcript: ENSMUST00000022666
AA Change: Y672C

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000022666
Gene: ENSMUSG00000022076
AA Change: Y672C

DomainStartEndE-ValueType
low complexity region 25 36 N/A INTRINSIC
low complexity region 74 90 N/A INTRINSIC
low complexity region 107 119 N/A INTRINSIC
BTB 215 312 1.13e-28 SMART
BACK 317 418 5.03e-34 SMART
Kelch 463 509 8.86e-10 SMART
Kelch 510 556 1.04e-15 SMART
Kelch 557 603 6.76e-15 SMART
Kelch 604 650 2.23e-15 SMART
Kelch 651 703 3.09e-9 SMART
Kelch 704 750 3.43e-16 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.8%
Validation Efficiency 99% (84/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The KLHL1 protein belongs to a family of actin-organizing proteins related to Drosophila Kelch (Nemes et al., 2000 [PubMed 10888605]).[supplied by OMIM, Feb 2010]
PHENOTYPE: Mice both homozygous and heterozygous for disruption of this gene develop abnormalities in gait and defects in motor coordination with time. Dendritic atrophy of Purkinje cells is also seen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700086D15Rik A G 11: 65,152,530 probably benign Het
4931408C20Rik T C 1: 26,682,934 Y1055C probably benign Het
6430548M08Rik T C 8: 120,145,482 S50P probably damaging Het
Aacs A G 5: 125,506,163 D261G probably benign Het
Abcc4 T A 14: 118,594,894 T775S probably benign Het
Acsl6 A G 11: 54,341,756 probably null Het
Agbl5 T A 5: 30,904,717 F196I probably benign Het
Ahnak2 T C 12: 112,774,684 T985A possibly damaging Het
Ak1 A T 2: 32,631,122 D101V possibly damaging Het
Alx1 A G 10: 103,025,200 Y156H probably damaging Het
Angptl7 T A 4: 148,500,031 S87C probably benign Het
Ankrd36 A G 11: 5,629,299 T188A probably benign Het
Arhgap11a A C 2: 113,839,709 S356R possibly damaging Het
Ascc3 G T 10: 50,645,753 E455* probably null Het
Atp6v0a2 G A 5: 124,712,161 probably null Het
B3gnt7 T C 1: 86,305,694 W104R probably damaging Het
Bbs9 G A 9: 22,812,544 probably null Het
Cc2d2a T A 5: 43,703,215 D544E probably benign Het
Cic C T 7: 25,271,777 T311I probably benign Het
Cngb1 T A 8: 95,248,375 R1157W probably null Het
Cntln A G 4: 85,115,368 H1310R probably benign Het
Cntnap5c A T 17: 58,293,953 I764F probably benign Het
Col26a1 T C 5: 136,744,234 Q362R possibly damaging Het
Cyp2c29 G A 19: 39,291,141 R100K probably benign Het
D17H6S53E C G 17: 35,127,246 D44E probably damaging Het
Dap3 A G 3: 88,930,989 V65A probably damaging Het
Dna2 A T 10: 62,957,003 I266F probably damaging Het
Dnah14 G A 1: 181,585,066 G57E probably benign Het
Dock9 A T 14: 121,643,152 V333E probably benign Het
Dpm1 A G 2: 168,230,275 Y27H probably damaging Het
Dsp A T 13: 38,167,655 Y150F possibly damaging Het
Emilin3 A T 2: 160,908,098 I577N probably damaging Het
Erap1 A G 13: 74,671,433 T189A probably benign Het
Fam208a T A 14: 27,449,801 L397* probably null Het
Fat2 A G 11: 55,282,771 I2372T possibly damaging Het
Fbn2 A T 18: 58,124,187 probably null Het
Gnl1 A T 17: 35,987,533 R390* probably null Het
Hivep1 A G 13: 42,183,452 I2336V probably benign Het
Il17rb C G 14: 30,004,271 probably null Het
Itga9 T C 9: 118,887,815 W396R probably damaging Het
Katnal2 A G 18: 77,011,038 V152A probably benign Het
Kcnk3 A G 5: 30,622,400 T265A probably benign Het
Leng8 C A 7: 4,143,626 N412K possibly damaging Het
Lrrc9 T A 12: 72,506,393 F1356L probably benign Het
Map7 A G 10: 20,171,082 probably benign Het
Mei1 T C 15: 82,081,930 F251S probably damaging Het
Mia2 A G 12: 59,129,895 E9G possibly damaging Het
Ms4a13 C A 19: 11,171,885 W182C probably benign Het
Muc16 C T 9: 18,660,299 R308K unknown Het
Olfr1195 G A 2: 88,683,684 T16I possibly damaging Het
Olfr936 A G 9: 39,047,531 probably benign Het
Pcnt A G 10: 76,385,798 V1998A probably benign Het
Pgm1 A T 5: 64,097,025 N51I probably benign Het
Piezo1 T A 8: 122,490,281 H1333L probably damaging Het
Prg2 G A 2: 84,983,256 V199M probably damaging Het
Prss51 T C 14: 64,097,488 V182A probably damaging Het
Psmb9 A T 17: 34,183,225 Y132* probably null Het
Ralyl T C 3: 13,777,031 Y76H probably damaging Het
Rnaset2a A T 17: 8,130,282 D174E probably benign Het
Rnft1 G A 11: 86,495,330 probably null Het
Robo2 T C 16: 73,961,867 Y676C probably damaging Het
Samd9l T G 6: 3,376,313 Y316S possibly damaging Het
Siah3 T A 14: 75,456,138 F28Y possibly damaging Het
Slc28a3 C T 13: 58,573,443 probably null Het
Slc8a1 A G 17: 81,388,872 F911S probably damaging Het
Speg T A 1: 75,387,908 L156* probably null Het
Spopl T G 2: 23,517,861 M269L probably benign Het
Tacr1 C T 6: 82,557,073 T360I probably benign Het
Tmem262 A G 19: 6,080,737 E95G probably benign Het
Tmem68 G T 4: 3,569,669 T7N possibly damaging Het
Top3a T A 11: 60,749,493 I460F probably damaging Het
Trafd1 G A 5: 121,384,074 R5* probably null Het
Trim16 T A 11: 62,840,869 V435D possibly damaging Het
Tspan17 A G 13: 54,796,033 D236G probably damaging Het
Tssk2 A T 16: 17,899,701 M323L probably benign Het
Ubqln5 A G 7: 104,129,008 V203A probably benign Het
Utrn A T 10: 12,693,470 L1134* probably null Het
Vmn1r37 C T 6: 66,731,720 S73F possibly damaging Het
Vps13c A G 9: 67,927,452 K1688E probably damaging Het
Zbtb39 A G 10: 127,741,842 D95G probably damaging Het
Zfhx3 T A 8: 108,800,528 I1019N probably damaging Het
Zfp207 C T 11: 80,395,503 probably benign Het
Zmiz1 C T 14: 25,643,638 T169M probably damaging Het
Other mutations in Klhl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01573:Klhl1 APN 14 96201204 splice site probably benign
IGL02055:Klhl1 APN 14 96280103 missense possibly damaging 0.96
IGL02110:Klhl1 APN 14 96136603 missense probably benign 0.27
IGL02216:Klhl1 APN 14 96123222 missense probably benign 0.08
IGL02307:Klhl1 APN 14 96201373 missense possibly damaging 0.68
IGL02538:Klhl1 APN 14 96240213 missense probably benign 0.03
IGL02559:Klhl1 APN 14 96151960 missense possibly damaging 0.95
IGL02682:Klhl1 APN 14 96201342 missense possibly damaging 0.83
IGL03228:Klhl1 APN 14 96240327 missense probably damaging 1.00
LCD18:Klhl1 UTSW 14 96317730 intron probably benign
P0041:Klhl1 UTSW 14 96280211 missense probably damaging 1.00
R0270:Klhl1 UTSW 14 96518344 start gained probably benign
R0419:Klhl1 UTSW 14 96381789 missense probably benign 0.30
R0938:Klhl1 UTSW 14 96152040 nonsense probably null
R1465:Klhl1 UTSW 14 96240213 missense probably benign 0.03
R1465:Klhl1 UTSW 14 96240213 missense probably benign 0.03
R1590:Klhl1 UTSW 14 96368636 missense probably damaging 1.00
R1597:Klhl1 UTSW 14 96201211 critical splice donor site probably null
R1893:Klhl1 UTSW 14 96240206 critical splice donor site probably null
R1928:Klhl1 UTSW 14 96346789 missense probably benign 0.02
R2272:Klhl1 UTSW 14 96517908 missense probably benign 0.00
R3612:Klhl1 UTSW 14 96381770 critical splice donor site probably null
R3852:Klhl1 UTSW 14 96280205 missense probably benign 0.12
R3872:Klhl1 UTSW 14 96518179 missense probably benign 0.03
R3874:Klhl1 UTSW 14 96518179 missense probably benign 0.03
R3923:Klhl1 UTSW 14 96346880 missense possibly damaging 0.46
R3925:Klhl1 UTSW 14 96346880 missense possibly damaging 0.46
R3926:Klhl1 UTSW 14 96346880 missense possibly damaging 0.46
R4151:Klhl1 UTSW 14 96518316 start codon destroyed probably null 0.73
R4502:Klhl1 UTSW 14 96517846 missense probably benign
R4536:Klhl1 UTSW 14 96136583 critical splice donor site probably null
R4729:Klhl1 UTSW 14 96280148 missense probably damaging 1.00
R4756:Klhl1 UTSW 14 96151966 missense probably benign 0.39
R5001:Klhl1 UTSW 14 96136610 missense probably damaging 0.96
R5022:Klhl1 UTSW 14 96136706 missense probably benign 0.31
R5616:Klhl1 UTSW 14 96518293 missense probably benign 0.44
R5634:Klhl1 UTSW 14 96240271 missense probably damaging 0.96
R5700:Klhl1 UTSW 14 96518040 missense probably benign
R5701:Klhl1 UTSW 14 96201380 missense probably benign
R5934:Klhl1 UTSW 14 96123215 critical splice donor site probably null
R5950:Klhl1 UTSW 14 96240354 missense probably damaging 0.99
R6454:Klhl1 UTSW 14 96280091 missense possibly damaging 0.66
R6496:Klhl1 UTSW 14 96240216 missense probably benign 0.03
R6606:Klhl1 UTSW 14 96123222 missense possibly damaging 0.52
R6644:Klhl1 UTSW 14 96517918 missense probably benign
R6745:Klhl1 UTSW 14 96280002 critical splice donor site probably null
R7029:Klhl1 UTSW 14 96518196 missense probably benign 0.01
R7195:Klhl1 UTSW 14 96280077 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- TGTGCATGGCATCTAAGCATC -3'
(R):5'- CGAGATGGAAGTTCCTGTCTG -3'

Sequencing Primer
(F):5'- GTGCATGGCATCTAAGCATCATATGG -3'
(R):5'- GTTCCTGTCTGAGTTCAATGGAATAC -3'
Posted On2018-11-06