Incidental Mutation 'R6919:Robo2'
ID539539
Institutional Source Beutler Lab
Gene Symbol Robo2
Ensembl Gene ENSMUSG00000052516
Gene Nameroundabout guidance receptor 2
Synonyms9430089E08Rik, 2600013A04Rik, D230004I22Rik
Accession Numbers

Ncbi RefSeq: NM_175549.4; MGI:1890110

Is this an essential gene? Probably essential (E-score: 0.871) question?
Stock #R6919 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location73891839-74411825 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 73961867 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 676 (Y676C)
Ref Sequence ENSEMBL: ENSMUSP00000154010 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117200] [ENSMUST00000117785] [ENSMUST00000226478] [ENSMUST00000227347]
Predicted Effect probably damaging
Transcript: ENSMUST00000117200
AA Change: Y672C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113795
Gene: ENSMUSG00000052516
AA Change: Y672C

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IGc2 43 117 3.56e-9 SMART
IGc2 145 210 3.33e-9 SMART
IGc2 237 300 6.59e-13 SMART
IGc2 326 398 1.3e-11 SMART
IGc2 430 495 3.73e-12 SMART
FN3 522 604 1.42e-15 SMART
FN3 636 721 3.54e-2 SMART
FN3 736 823 6.15e-11 SMART
transmembrane domain 860 882 N/A INTRINSIC
low complexity region 1040 1065 N/A INTRINSIC
low complexity region 1072 1083 N/A INTRINSIC
low complexity region 1191 1199 N/A INTRINSIC
low complexity region 1210 1234 N/A INTRINSIC
low complexity region 1318 1342 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000117785
AA Change: Y672C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112776
Gene: ENSMUSG00000052516
AA Change: Y672C

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IGc2 43 117 3.56e-9 SMART
IGc2 145 210 3.33e-9 SMART
IGc2 237 300 6.59e-13 SMART
IGc2 326 398 1.3e-11 SMART
IGc2 430 495 3.73e-12 SMART
FN3 522 604 1.42e-15 SMART
FN3 636 721 3.54e-2 SMART
FN3 736 823 6.15e-11 SMART
transmembrane domain 860 882 N/A INTRINSIC
low complexity region 1072 1107 N/A INTRINSIC
low complexity region 1114 1125 N/A INTRINSIC
low complexity region 1233 1241 N/A INTRINSIC
low complexity region 1252 1276 N/A INTRINSIC
low complexity region 1351 1362 N/A INTRINSIC
low complexity region 1451 1475 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000226478
AA Change: Y676C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000227347
AA Change: Y676C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000231889
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.8%
Validation Efficiency 99% (84/85)
MGI Phenotype Strain: 3759448; 3043127
Lethality: D1
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the ROBO family, part of the immunoglobulin superfamily of proteins that are highly conserved from fly to human. The encoded protein is a transmembrane receptor for the slit homolog 2 protein and functions in axon guidance and cell migration. Mutations in this gene are associated with vesicoureteral reflux, characterized by the backward flow of urine from the bladder into the ureters or the kidney. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygous mutants display postnatal lethality, abnormal ureteric bud development, multiple fused kidneys, multiple ureters, and abnormal commissural axon growth. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted(3) Gene trapped(3)

Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700086D15Rik A G 11: 65,152,530 probably benign Het
4931408C20Rik T C 1: 26,682,934 Y1055C probably benign Het
6430548M08Rik T C 8: 120,145,482 S50P probably damaging Het
Aacs A G 5: 125,506,163 D261G probably benign Het
Abcc4 T A 14: 118,594,894 T775S probably benign Het
Acsl6 A G 11: 54,341,756 probably null Het
Agbl5 T A 5: 30,904,717 F196I probably benign Het
Ahnak2 T C 12: 112,774,684 T985A possibly damaging Het
Ak1 A T 2: 32,631,122 D101V possibly damaging Het
Alx1 A G 10: 103,025,200 Y156H probably damaging Het
Angptl7 T A 4: 148,500,031 S87C probably benign Het
Ankrd36 A G 11: 5,629,299 T188A probably benign Het
Arhgap11a A C 2: 113,839,709 S356R possibly damaging Het
Ascc3 G T 10: 50,645,753 E455* probably null Het
Atp6v0a2 G A 5: 124,712,161 probably null Het
B3gnt7 T C 1: 86,305,694 W104R probably damaging Het
Bbs9 G A 9: 22,812,544 probably null Het
Cc2d2a T A 5: 43,703,215 D544E probably benign Het
Cic C T 7: 25,271,777 T311I probably benign Het
Cngb1 T A 8: 95,248,375 R1157W probably null Het
Cntln A G 4: 85,115,368 H1310R probably benign Het
Cntnap5c A T 17: 58,293,953 I764F probably benign Het
Col26a1 T C 5: 136,744,234 Q362R possibly damaging Het
Cyp2c29 G A 19: 39,291,141 R100K probably benign Het
D17H6S53E C G 17: 35,127,246 D44E probably damaging Het
Dap3 A G 3: 88,930,989 V65A probably damaging Het
Dna2 A T 10: 62,957,003 I266F probably damaging Het
Dnah14 G A 1: 181,585,066 G57E probably benign Het
Dock9 A T 14: 121,643,152 V333E probably benign Het
Dpm1 A G 2: 168,230,275 Y27H probably damaging Het
Dsp A T 13: 38,167,655 Y150F possibly damaging Het
Emilin3 A T 2: 160,908,098 I577N probably damaging Het
Erap1 A G 13: 74,671,433 T189A probably benign Het
Fam208a T A 14: 27,449,801 L397* probably null Het
Fat2 A G 11: 55,282,771 I2372T possibly damaging Het
Fbn2 A T 18: 58,124,187 probably null Het
Gnl1 A T 17: 35,987,533 R390* probably null Het
Hivep1 A G 13: 42,183,452 I2336V probably benign Het
Il17rb C G 14: 30,004,271 probably null Het
Itga9 T C 9: 118,887,815 W396R probably damaging Het
Katnal2 A G 18: 77,011,038 V152A probably benign Het
Kcnk3 A G 5: 30,622,400 T265A probably benign Het
Klhl1 T C 14: 96,136,594 Y672C probably benign Het
Leng8 C A 7: 4,143,626 N412K possibly damaging Het
Lrrc9 T A 12: 72,506,393 F1356L probably benign Het
Map7 A G 10: 20,171,082 probably benign Het
Mei1 T C 15: 82,081,930 F251S probably damaging Het
Mia2 A G 12: 59,129,895 E9G possibly damaging Het
Ms4a13 C A 19: 11,171,885 W182C probably benign Het
Muc16 C T 9: 18,660,299 R308K unknown Het
Olfr1195 G A 2: 88,683,684 T16I possibly damaging Het
Olfr936 A G 9: 39,047,531 probably benign Het
Pcnt A G 10: 76,385,798 V1998A probably benign Het
Pgm1 A T 5: 64,097,025 N51I probably benign Het
Piezo1 T A 8: 122,490,281 H1333L probably damaging Het
Prg2 G A 2: 84,983,256 V199M probably damaging Het
Prss51 T C 14: 64,097,488 V182A probably damaging Het
Psmb9 A T 17: 34,183,225 Y132* probably null Het
Ralyl T C 3: 13,777,031 Y76H probably damaging Het
Rnaset2a A T 17: 8,130,282 D174E probably benign Het
Rnft1 G A 11: 86,495,330 probably null Het
Samd9l T G 6: 3,376,313 Y316S possibly damaging Het
Siah3 T A 14: 75,456,138 F28Y possibly damaging Het
Slc28a3 C T 13: 58,573,443 probably null Het
Slc8a1 A G 17: 81,388,872 F911S probably damaging Het
Speg T A 1: 75,387,908 L156* probably null Het
Spopl T G 2: 23,517,861 M269L probably benign Het
Tacr1 C T 6: 82,557,073 T360I probably benign Het
Tmem262 A G 19: 6,080,737 E95G probably benign Het
Tmem68 G T 4: 3,569,669 T7N possibly damaging Het
Top3a T A 11: 60,749,493 I460F probably damaging Het
Trafd1 G A 5: 121,384,074 R5* probably null Het
Trim16 T A 11: 62,840,869 V435D possibly damaging Het
Tspan17 A G 13: 54,796,033 D236G probably damaging Het
Tssk2 A T 16: 17,899,701 M323L probably benign Het
Ubqln5 A G 7: 104,129,008 V203A probably benign Het
Utrn A T 10: 12,693,470 L1134* probably null Het
Vmn1r37 C T 6: 66,731,720 S73F possibly damaging Het
Vps13c A G 9: 67,927,452 K1688E probably damaging Het
Zbtb39 A G 10: 127,741,842 D95G probably damaging Het
Zfhx3 T A 8: 108,800,528 I1019N probably damaging Het
Zfp207 C T 11: 80,395,503 probably benign Het
Zmiz1 C T 14: 25,643,638 T169M probably damaging Het
Other mutations in Robo2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00666:Robo2 APN 16 73961700 missense probably benign
IGL00849:Robo2 APN 16 73973777 missense possibly damaging 0.80
IGL00908:Robo2 APN 16 73985691 missense probably damaging 0.98
IGL00944:Robo2 APN 16 73933697 missense possibly damaging 0.92
IGL00955:Robo2 APN 16 74015972 missense probably damaging 1.00
IGL00970:Robo2 APN 16 73897046 missense probably benign 0.00
IGL01020:Robo2 APN 16 73928151 missense probably benign 0.06
IGL01347:Robo2 APN 16 74352856 missense probably damaging 1.00
IGL02280:Robo2 APN 16 74046816 missense probably damaging 1.00
IGL02424:Robo2 APN 16 73973301 missense possibly damaging 0.89
IGL03376:Robo2 APN 16 73956492 missense probably damaging 1.00
LCD18:Robo2 UTSW 16 74055954 intron probably benign
P0018:Robo2 UTSW 16 74046806 missense possibly damaging 0.82
R0314:Robo2 UTSW 16 73956637 missense probably damaging 1.00
R0324:Robo2 UTSW 16 73967851 missense probably damaging 1.00
R0539:Robo2 UTSW 16 73985574 splice site probably benign
R0620:Robo2 UTSW 16 73967802 missense possibly damaging 0.92
R0630:Robo2 UTSW 16 73916205 missense probably benign 0.05
R0701:Robo2 UTSW 16 74046874 missense probably damaging 1.00
R1155:Robo2 UTSW 16 74035108 missense probably damaging 1.00
R1168:Robo2 UTSW 16 73948296 missense probably damaging 1.00
R1195:Robo2 UTSW 16 73916128 unclassified probably null
R1195:Robo2 UTSW 16 73916128 unclassified probably null
R1195:Robo2 UTSW 16 73916128 unclassified probably null
R1317:Robo2 UTSW 16 74035024 missense probably damaging 1.00
R1422:Robo2 UTSW 16 73978448 missense probably damaging 0.99
R1452:Robo2 UTSW 16 73961910 missense probably damaging 1.00
R1649:Robo2 UTSW 16 73899001 missense probably benign 0.36
R1709:Robo2 UTSW 16 73956523 missense possibly damaging 0.83
R1751:Robo2 UTSW 16 74035024 missense probably damaging 1.00
R1761:Robo2 UTSW 16 74035024 missense probably damaging 1.00
R1885:Robo2 UTSW 16 73916145 missense probably benign 0.00
R1911:Robo2 UTSW 16 73958325 missense probably damaging 1.00
R1919:Robo2 UTSW 16 73899154 missense probably benign
R2005:Robo2 UTSW 16 73933115 missense possibly damaging 0.82
R2851:Robo2 UTSW 16 73961888 missense probably damaging 1.00
R3732:Robo2 UTSW 16 73920747 missense possibly damaging 0.64
R3732:Robo2 UTSW 16 73920747 missense possibly damaging 0.64
R3733:Robo2 UTSW 16 73920747 missense possibly damaging 0.64
R3734:Robo2 UTSW 16 73920747 missense possibly damaging 0.64
R3913:Robo2 UTSW 16 74035005 missense probably damaging 1.00
R3956:Robo2 UTSW 16 73961867 missense probably damaging 1.00
R4394:Robo2 UTSW 16 73948379 missense probably benign 0.13
R4426:Robo2 UTSW 16 73948266 missense probably damaging 1.00
R4437:Robo2 UTSW 16 73973244 missense possibly damaging 0.88
R4454:Robo2 UTSW 16 74352519 intron probably benign
R4478:Robo2 UTSW 16 74015873 missense probably damaging 1.00
R4586:Robo2 UTSW 16 73961873 missense probably damaging 0.96
R4621:Robo2 UTSW 16 73985933 missense probably benign 0.00
R4673:Robo2 UTSW 16 73904378 splice site probably null
R4798:Robo2 UTSW 16 74352745 missense probably damaging 1.00
R4812:Robo2 UTSW 16 73916288 missense probably benign 0.00
R4855:Robo2 UTSW 16 73971191 missense probably damaging 1.00
R4910:Robo2 UTSW 16 73933778 missense probably damaging 0.99
R4916:Robo2 UTSW 16 73898915 missense possibly damaging 0.53
R4948:Robo2 UTSW 16 74352838 missense possibly damaging 0.88
R5325:Robo2 UTSW 16 73973785 missense possibly damaging 0.72
R5326:Robo2 UTSW 16 73898965 missense probably benign 0.20
R5447:Robo2 UTSW 16 73973766 nonsense probably null
R5542:Robo2 UTSW 16 73898965 missense probably benign 0.20
R5545:Robo2 UTSW 16 73961747 missense probably damaging 1.00
R5646:Robo2 UTSW 16 73961819 missense probably damaging 0.99
R5734:Robo2 UTSW 16 74352784 missense probably damaging 1.00
R5892:Robo2 UTSW 16 73895780 utr 3 prime probably benign
R5960:Robo2 UTSW 16 73933715 missense probably damaging 1.00
R6126:Robo2 UTSW 16 73920682 missense probably benign 0.00
R6130:Robo2 UTSW 16 73920682 missense probably benign 0.00
R6153:Robo2 UTSW 16 73920729 missense probably damaging 1.00
R6240:Robo2 UTSW 16 73982139 missense probably damaging 1.00
R6247:Robo2 UTSW 16 73967784 missense probably damaging 1.00
R6304:Robo2 UTSW 16 73958308 missense probably damaging 1.00
R6337:Robo2 UTSW 16 73928151 missense probably benign 0.06
R6431:Robo2 UTSW 16 74046809 nonsense probably null
R6440:Robo2 UTSW 16 73916122 missense probably benign 0.31
R6596:Robo2 UTSW 16 73971108 missense probably damaging 1.00
R6927:Robo2 UTSW 16 73982058 missense probably damaging 1.00
R7029:Robo2 UTSW 16 73948337 missense probably damaging 1.00
R7078:Robo2 UTSW 16 74352616 missense probably damaging 1.00
R7092:Robo2 UTSW 16 73956643 missense probably damaging 0.99
R7136:Robo2 UTSW 16 73956550 missense probably damaging 0.99
X0063:Robo2 UTSW 16 74045828 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGGACTGTTTTCGATTCACTG -3'
(R):5'- ATTGGCGTGCTCATCACTTTTG -3'

Sequencing Primer
(F):5'- GACTGTTTTCGATTCACTGTCCATTC -3'
(R):5'- GCCATTGAAGGACATTATTTGAGGC -3'
Posted On2018-11-06