Incidental Mutation 'R6919:Slc8a1'
ID539545
Institutional Source Beutler Lab
Gene Symbol Slc8a1
Ensembl Gene ENSMUSG00000054640
Gene Namesolute carrier family 8 (sodium/calcium exchanger), member 1
SynonymsNcx1, D930008O12Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6919 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location81388691-81649607 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 81388872 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 911 (F911S)
Ref Sequence ENSEMBL: ENSMUSP00000126373 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086538] [ENSMUST00000163123] [ENSMUST00000163680]
Predicted Effect probably damaging
Transcript: ENSMUST00000086538
AA Change: F911S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000083725
Gene: ENSMUSG00000054640
AA Change: F911S

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:Na_Ca_ex 77 248 3.8e-38 PFAM
Pfam:Na_Ca_ex_C 251 386 2e-53 PFAM
Calx_beta 393 493 1.28e-49 SMART
Calx_beta 524 624 8.25e-44 SMART
low complexity region 754 765 N/A INTRINSIC
Pfam:Na_Ca_ex 796 961 2.4e-29 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000163123
AA Change: F899S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132809
Gene: ENSMUSG00000054640
AA Change: F899S

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:Na_Ca_ex 87 246 4.6e-38 PFAM
coiled coil region 313 332 N/A INTRINSIC
Calx_beta 393 493 1.28e-49 SMART
Calx_beta 524 624 8.25e-44 SMART
low complexity region 742 753 N/A INTRINSIC
Pfam:Na_Ca_ex 794 947 1.2e-28 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000163680
AA Change: F911S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126373
Gene: ENSMUSG00000054640
AA Change: F911S

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:Na_Ca_ex 77 248 3.8e-38 PFAM
Pfam:Na_Ca_ex_C 251 386 2e-53 PFAM
Calx_beta 393 493 1.28e-49 SMART
Calx_beta 524 624 8.25e-44 SMART
low complexity region 754 765 N/A INTRINSIC
Pfam:Na_Ca_ex 796 961 2.4e-29 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.8%
Validation Efficiency 99% (84/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] In cardiac myocytes, Ca(2+) concentrations alternate between high levels during contraction and low levels during relaxation. The increase in Ca(2+) concentration during contraction is primarily due to release of Ca(2+) from intracellular stores. However, some Ca(2+) also enters the cell through the sarcolemma (plasma membrane). During relaxation, Ca(2+) is sequestered within the intracellular stores. To prevent overloading of intracellular stores, the Ca(2+) that entered across the sarcolemma must be extruded from the cell. The Na(+)-Ca(2+) exchanger is the primary mechanism by which the Ca(2+) is extruded from the cell during relaxation. In the heart, the exchanger may play a key role in digitalis action. The exchanger is the dominant mechanism in returning the cardiac myocyte to its resting state following excitation.[supplied by OMIM, Apr 2004]
PHENOTYPE: Homozygotes for targeted null mutations have underdeveloped, nonbeating hearts with massive apoptosis of myocytes, a dilated pericardium and die around embryonic day 9.5. Heterozygotes exhibit altered responses to experimental cardiac pressure overload. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700086D15Rik A G 11: 65,152,530 probably benign Het
4931408C20Rik T C 1: 26,682,934 Y1055C probably benign Het
6430548M08Rik T C 8: 120,145,482 S50P probably damaging Het
Aacs A G 5: 125,506,163 D261G probably benign Het
Abcc4 T A 14: 118,594,894 T775S probably benign Het
Acsl6 A G 11: 54,341,756 probably null Het
Agbl5 T A 5: 30,904,717 F196I probably benign Het
Ahnak2 T C 12: 112,774,684 T985A possibly damaging Het
Ak1 A T 2: 32,631,122 D101V possibly damaging Het
Alx1 A G 10: 103,025,200 Y156H probably damaging Het
Angptl7 T A 4: 148,500,031 S87C probably benign Het
Ankrd36 A G 11: 5,629,299 T188A probably benign Het
Arhgap11a A C 2: 113,839,709 S356R possibly damaging Het
Ascc3 G T 10: 50,645,753 E455* probably null Het
Atp6v0a2 G A 5: 124,712,161 probably null Het
B3gnt7 T C 1: 86,305,694 W104R probably damaging Het
Bbs9 G A 9: 22,812,544 probably null Het
Cc2d2a T A 5: 43,703,215 D544E probably benign Het
Cic C T 7: 25,271,777 T311I probably benign Het
Cngb1 T A 8: 95,248,375 R1157W probably null Het
Cntln A G 4: 85,115,368 H1310R probably benign Het
Cntnap5c A T 17: 58,293,953 I764F probably benign Het
Col26a1 T C 5: 136,744,234 Q362R possibly damaging Het
Cyp2c29 G A 19: 39,291,141 R100K probably benign Het
D17H6S53E C G 17: 35,127,246 D44E probably damaging Het
Dap3 A G 3: 88,930,989 V65A probably damaging Het
Dna2 A T 10: 62,957,003 I266F probably damaging Het
Dnah14 G A 1: 181,585,066 G57E probably benign Het
Dock9 A T 14: 121,643,152 V333E probably benign Het
Dpm1 A G 2: 168,230,275 Y27H probably damaging Het
Dsp A T 13: 38,167,655 Y150F possibly damaging Het
Emilin3 A T 2: 160,908,098 I577N probably damaging Het
Erap1 A G 13: 74,671,433 T189A probably benign Het
Fam208a T A 14: 27,449,801 L397* probably null Het
Fat2 A G 11: 55,282,771 I2372T possibly damaging Het
Fbn2 A T 18: 58,124,187 probably null Het
Gnl1 A T 17: 35,987,533 R390* probably null Het
Hivep1 A G 13: 42,183,452 I2336V probably benign Het
Il17rb C G 14: 30,004,271 probably null Het
Itga9 T C 9: 118,887,815 W396R probably damaging Het
Katnal2 A G 18: 77,011,038 V152A probably benign Het
Kcnk3 A G 5: 30,622,400 T265A probably benign Het
Klhl1 T C 14: 96,136,594 Y672C probably benign Het
Leng8 C A 7: 4,143,626 N412K possibly damaging Het
Lrrc9 T A 12: 72,506,393 F1356L probably benign Het
Map7 A G 10: 20,171,082 probably benign Het
Mei1 T C 15: 82,081,930 F251S probably damaging Het
Mia2 A G 12: 59,129,895 E9G possibly damaging Het
Ms4a13 C A 19: 11,171,885 W182C probably benign Het
Muc16 C T 9: 18,660,299 R308K unknown Het
Olfr1195 G A 2: 88,683,684 T16I possibly damaging Het
Olfr936 A G 9: 39,047,531 probably benign Het
Pcnt A G 10: 76,385,798 V1998A probably benign Het
Pgm1 A T 5: 64,097,025 N51I probably benign Het
Piezo1 T A 8: 122,490,281 H1333L probably damaging Het
Prg2 G A 2: 84,983,256 V199M probably damaging Het
Prss51 T C 14: 64,097,488 V182A probably damaging Het
Psmb9 A T 17: 34,183,225 Y132* probably null Het
Ralyl T C 3: 13,777,031 Y76H probably damaging Het
Rnaset2a A T 17: 8,130,282 D174E probably benign Het
Rnft1 G A 11: 86,495,330 probably null Het
Robo2 T C 16: 73,961,867 Y676C probably damaging Het
Samd9l T G 6: 3,376,313 Y316S possibly damaging Het
Siah3 T A 14: 75,456,138 F28Y possibly damaging Het
Slc28a3 C T 13: 58,573,443 probably null Het
Speg T A 1: 75,387,908 L156* probably null Het
Spopl T G 2: 23,517,861 M269L probably benign Het
Tacr1 C T 6: 82,557,073 T360I probably benign Het
Tmem262 A G 19: 6,080,737 E95G probably benign Het
Tmem68 G T 4: 3,569,669 T7N possibly damaging Het
Top3a T A 11: 60,749,493 I460F probably damaging Het
Trafd1 G A 5: 121,384,074 R5* probably null Het
Trim16 T A 11: 62,840,869 V435D possibly damaging Het
Tspan17 A G 13: 54,796,033 D236G probably damaging Het
Tssk2 A T 16: 17,899,701 M323L probably benign Het
Ubqln5 A G 7: 104,129,008 V203A probably benign Het
Utrn A T 10: 12,693,470 L1134* probably null Het
Vmn1r37 C T 6: 66,731,720 S73F possibly damaging Het
Vps13c A G 9: 67,927,452 K1688E probably damaging Het
Zbtb39 A G 10: 127,741,842 D95G probably damaging Het
Zfhx3 T A 8: 108,800,528 I1019N probably damaging Het
Zfp207 C T 11: 80,395,503 probably benign Het
Zmiz1 C T 14: 25,643,638 T169M probably damaging Het
Other mutations in Slc8a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00549:Slc8a1 APN 17 81649171 missense probably damaging 1.00
IGL00572:Slc8a1 APN 17 81388726 missense probably damaging 1.00
IGL00777:Slc8a1 APN 17 81648580 missense probably damaging 1.00
IGL00857:Slc8a1 APN 17 81647879 missense probably benign 0.03
IGL01068:Slc8a1 APN 17 81388942 missense probably benign 0.09
IGL01089:Slc8a1 APN 17 81648281 missense probably damaging 1.00
IGL01089:Slc8a1 APN 17 81388881 missense probably damaging 1.00
IGL01510:Slc8a1 APN 17 81648365 missense probably damaging 1.00
IGL01677:Slc8a1 APN 17 81648607 missense probably damaging 1.00
IGL01862:Slc8a1 APN 17 81442201 critical splice donor site probably null
IGL02003:Slc8a1 APN 17 81428196 missense possibly damaging 0.80
IGL02500:Slc8a1 APN 17 81388713 missense probably damaging 1.00
IGL02556:Slc8a1 APN 17 81648744 missense probably benign 0.24
IGL02800:Slc8a1 APN 17 81408323 missense probably benign 0.01
IGL03308:Slc8a1 APN 17 81442195 unclassified probably benign
IGL03391:Slc8a1 APN 17 81432638 splice site probably benign
cardinal UTSW 17 81648407 missense probably damaging 0.99
encyclical UTSW 17 81649454 missense probably damaging 1.00
PIT4498001:Slc8a1 UTSW 17 81648840 nonsense probably null
R0067:Slc8a1 UTSW 17 81437759 missense probably benign 0.00
R0067:Slc8a1 UTSW 17 81437759 missense probably benign 0.00
R0485:Slc8a1 UTSW 17 81647993 missense probably damaging 0.99
R0667:Slc8a1 UTSW 17 81648881 missense probably damaging 1.00
R0845:Slc8a1 UTSW 17 81437748 missense probably benign 0.05
R1073:Slc8a1 UTSW 17 81648407 missense probably damaging 0.99
R1417:Slc8a1 UTSW 17 81408280 missense probably damaging 1.00
R1510:Slc8a1 UTSW 17 81648118 missense probably damaging 1.00
R1546:Slc8a1 UTSW 17 81648247 missense probably damaging 1.00
R1625:Slc8a1 UTSW 17 81649241 missense probably damaging 1.00
R1806:Slc8a1 UTSW 17 81648487 missense probably damaging 1.00
R1879:Slc8a1 UTSW 17 81648013 missense probably damaging 1.00
R2025:Slc8a1 UTSW 17 81649112 missense probably damaging 1.00
R2187:Slc8a1 UTSW 17 81648553 missense possibly damaging 0.48
R2198:Slc8a1 UTSW 17 81408256 nonsense probably null
R3856:Slc8a1 UTSW 17 81648374 missense probably benign
R4067:Slc8a1 UTSW 17 81648274 missense probably damaging 1.00
R4224:Slc8a1 UTSW 17 81649352 missense probably damaging 1.00
R4225:Slc8a1 UTSW 17 81649352 missense probably damaging 1.00
R5028:Slc8a1 UTSW 17 81649273 missense possibly damaging 0.91
R5307:Slc8a1 UTSW 17 81649224 missense probably damaging 1.00
R5766:Slc8a1 UTSW 17 81648961 missense probably damaging 0.97
R5787:Slc8a1 UTSW 17 81388737 missense probably damaging 1.00
R5902:Slc8a1 UTSW 17 81408082 missense probably damaging 1.00
R5913:Slc8a1 UTSW 17 81648002 missense probably damaging 1.00
R6017:Slc8a1 UTSW 17 81648254 missense probably damaging 1.00
R6481:Slc8a1 UTSW 17 81388918 missense probably benign
R6670:Slc8a1 UTSW 17 81649454 missense probably damaging 1.00
R6714:Slc8a1 UTSW 17 81408249 missense probably damaging 1.00
R6914:Slc8a1 UTSW 17 81408120 missense probably damaging 1.00
R6942:Slc8a1 UTSW 17 81408120 missense probably damaging 1.00
R7057:Slc8a1 UTSW 17 81649095 missense probably damaging 1.00
X0024:Slc8a1 UTSW 17 81432762 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- TATGTGGCAGTAGGCTTCCAG -3'
(R):5'- AACTCAGTGTCATGGTCTGTTTC -3'

Sequencing Primer
(F):5'- CAGTAGGCTTCCAGGGAGG -3'
(R):5'- TTTGCCAGCAAAGTAGCAGC -3'
Posted On2018-11-06