Incidental Mutation 'R6921:1700017B05Rik'
ID539647
Institutional Source Beutler Lab
Gene Symbol 1700017B05Rik
Ensembl Gene ENSMUSG00000032300
Gene NameRIKEN cDNA 1700017B05 gene
SynonymsD9Ertd278e
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.220) question?
Stock #R6921 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location57253117-57262612 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 57258736 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 118 (H118Q)
Ref Sequence ENSEMBL: ENSMUSP00000150884 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034846] [ENSMUST00000213199] [ENSMUST00000215298] [ENSMUST00000217657]
Predicted Effect probably damaging
Transcript: ENSMUST00000034846
AA Change: H118Q

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000034846
Gene: ENSMUSG00000032300
AA Change: H118Q

DomainStartEndE-ValueType
low complexity region 265 284 N/A INTRINSIC
low complexity region 293 299 N/A INTRINSIC
low complexity region 334 347 N/A INTRINSIC
low complexity region 649 675 N/A INTRINSIC
low complexity region 692 728 N/A INTRINSIC
low complexity region 785 799 N/A INTRINSIC
low complexity region 933 951 N/A INTRINSIC
low complexity region 963 977 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000213199
AA Change: H118Q

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect probably benign
Transcript: ENSMUST00000215298
Predicted Effect probably benign
Transcript: ENSMUST00000217657
Meta Mutation Damage Score 0.0308 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 98.9%
  • 20x: 96.4%
Validation Efficiency 96% (46/48)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl3 T G 5: 81,648,713 V623G probably damaging Het
B9d2 A G 7: 25,686,017 D84G probably damaging Het
Clec1a A T 6: 129,428,864 L268H probably damaging Het
Copa A T 1: 172,111,924 N576I possibly damaging Het
Cyp11b1 T C 15: 74,840,949 T88A probably benign Het
Dis3l2 T C 1: 86,857,341 I318T probably benign Het
Dmtf1 T C 5: 9,130,654 probably benign Het
Dnah17 C A 11: 118,041,484 A3639S probably damaging Het
Dnajc8 T A 4: 132,544,720 I89N probably damaging Het
Dync2h1 T A 9: 7,102,549 H377L probably benign Het
Elmsan1 A G 12: 84,156,459 S890P probably damaging Het
Erfe T A 1: 91,370,332 I212N probably benign Het
Fam117b A G 1: 59,952,935 T248A probably damaging Het
Fbxo10 A T 4: 45,044,849 N595K probably damaging Het
Fzd10 T A 5: 128,601,582 M122K probably damaging Het
Gm4070 G A 7: 105,901,980 Q622* probably null Het
Gpr15 C T 16: 58,717,781 R315H probably benign Het
H6pd T C 4: 149,982,051 D626G probably damaging Het
Hexdc A G 11: 121,222,281 D514G probably damaging Het
Hoxd4 T C 2: 74,728,492 S220P possibly damaging Het
Invs A G 4: 48,396,260 H311R possibly damaging Het
Ip6k1 A G 9: 108,024,435 T70A probably damaging Het
Lipt2 T C 7: 100,160,371 C222R probably damaging Het
Lrrc3 T A 10: 77,901,032 D190V probably damaging Het
March10 T C 11: 105,389,777 T561A probably benign Het
Mcm10 G A 2: 5,000,935 T463I probably benign Het
Mmel1 T C 4: 154,881,677 L52P probably damaging Het
Nipbl T C 15: 8,303,485 N2218S probably benign Het
Nr4a3 C T 4: 48,051,486 P80L probably benign Het
Nrip1 C T 16: 76,292,588 G694R possibly damaging Het
Oit3 A T 10: 59,435,945 C197S probably damaging Het
Olfr1042 C T 2: 86,159,852 V173M probably benign Het
Olfr904 A G 9: 38,464,247 I69V probably benign Het
Otol1 A G 3: 70,028,100 E475G possibly damaging Het
Pes1 T C 11: 3,973,330 F168L probably damaging Het
Plch1 C T 3: 63,707,734 R780H possibly damaging Het
Pxdn C G 12: 30,015,505 P1275A probably damaging Het
Sgcz T C 8: 37,526,289 E218G probably damaging Het
Slc27a5 A T 7: 12,991,208 N437K probably damaging Het
Sult2b1 A G 7: 45,735,188 S155P probably damaging Het
Tgfbrap1 T C 1: 43,051,896 M690V probably benign Het
Tmem151a A T 19: 5,083,091 L29Q probably damaging Het
Tmprss2 A G 16: 97,568,437 I379T probably damaging Het
Vmn1r168 T A 7: 23,540,898 V60E probably damaging Het
Vmn2r73 A C 7: 85,858,238 V622G probably benign Het
Wdr72 A G 9: 74,210,646 H880R probably benign Het
Zfhx3 A G 8: 108,951,392 T3025A possibly damaging Het
Other mutations in 1700017B05Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01011:1700017B05Rik APN 9 57258246 missense probably damaging 1.00
IGL01287:1700017B05Rik APN 9 57257757 missense probably damaging 1.00
IGL01798:1700017B05Rik APN 9 57256638 missense probably benign 0.10
IGL01933:1700017B05Rik APN 9 57257367 missense possibly damaging 0.95
IGL02146:1700017B05Rik APN 9 57256740 missense possibly damaging 0.82
IGL02158:1700017B05Rik APN 9 57256619 unclassified probably null
IGL02277:1700017B05Rik APN 9 57258425 missense probably benign 0.05
IGL02707:1700017B05Rik APN 9 57258645 missense probably benign
IGL02887:1700017B05Rik APN 9 57258885 missense probably damaging 1.00
IGL02936:1700017B05Rik APN 9 57258404 missense possibly damaging 0.69
R0583:1700017B05Rik UTSW 9 57257643 missense probably benign 0.04
R0926:1700017B05Rik UTSW 9 57257549 missense probably damaging 0.99
R1812:1700017B05Rik UTSW 9 57257457 nonsense probably null
R1903:1700017B05Rik UTSW 9 57258352 missense possibly damaging 0.69
R4542:1700017B05Rik UTSW 9 57256592 missense probably damaging 1.00
R4596:1700017B05Rik UTSW 9 57257805 missense probably benign 0.03
R4631:1700017B05Rik UTSW 9 57257987 missense probably damaging 1.00
R4869:1700017B05Rik UTSW 9 57254205 missense probably damaging 1.00
R5265:1700017B05Rik UTSW 9 57258894 missense probably damaging 1.00
R5361:1700017B05Rik UTSW 9 57257185 missense probably damaging 1.00
R6216:1700017B05Rik UTSW 9 57257627 missense probably benign 0.33
R6356:1700017B05Rik UTSW 9 57254009 missense probably benign 0.11
R6579:1700017B05Rik UTSW 9 57254224 missense possibly damaging 0.89
R6774:1700017B05Rik UTSW 9 57256625 missense probably damaging 1.00
R7089:1700017B05Rik UTSW 9 57258758 missense probably damaging 1.00
R7196:1700017B05Rik UTSW 9 57258222 frame shift probably null
R7197:1700017B05Rik UTSW 9 57258222 frame shift probably null
Predicted Primers PCR Primer
(F):5'- CAGATGGTAGTCCTCGCAAG -3'
(R):5'- GGACTCCTGCAATTACAAAGGTG -3'

Sequencing Primer
(F):5'- CTTGCCAGGAGCTGTAGC -3'
(R):5'- ACAAAGGTGCATATTTCTCCTGC -3'
Posted On2018-11-06