Incidental Mutation 'R6921:Hexdc'
ID539655
Institutional Source Beutler Lab
Gene Symbol Hexdc
Ensembl Gene ENSMUSG00000039307
Gene Namehexosaminidase (glycosyl hydrolase family 20, catalytic domain) containing
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R6921 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location121204433-121222655 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 121222281 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 514 (D514G)
Ref Sequence ENSEMBL: ENSMUSP00000048479 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038709] [ENSMUST00000038831] [ENSMUST00000106115] [ENSMUST00000106117] [ENSMUST00000137299] [ENSMUST00000147490] [ENSMUST00000169393]
Predicted Effect probably benign
Transcript: ENSMUST00000038709
SMART Domains Protein: ENSMUSP00000042277
Gene: ENSMUSG00000039294

DomainStartEndE-ValueType
Pfam:DUF4564 1 187 1e-85 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000038831
AA Change: D514G

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000048479
Gene: ENSMUSG00000039307
AA Change: D514G

DomainStartEndE-ValueType
Pfam:Glyco_hydro_20 30 223 2.9e-12 PFAM
low complexity region 528 538 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106115
SMART Domains Protein: ENSMUSP00000101721
Gene: ENSMUSG00000039294

DomainStartEndE-ValueType
Pfam:DUF4564 2 184 3e-88 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106117
AA Change: D441G

PolyPhen 2 Score 0.353 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000101723
Gene: ENSMUSG00000039307
AA Change: D441G

DomainStartEndE-ValueType
Pfam:Glyco_hydro_20 31 229 1.7e-18 PFAM
low complexity region 455 465 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124761
SMART Domains Protein: ENSMUSP00000116406
Gene: ENSMUSG00000039307

DomainStartEndE-ValueType
Pfam:Glyco_hydro_20 20 194 6.1e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137299
SMART Domains Protein: ENSMUSP00000120541
Gene: ENSMUSG00000039294

DomainStartEndE-ValueType
Pfam:DUF4564 1 150 9.9e-75 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147490
SMART Domains Protein: ENSMUSP00000117829
Gene: ENSMUSG00000039294

DomainStartEndE-ValueType
Pfam:DUF4564 1 132 7.2e-65 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000123073
Gene: ENSMUSG00000039307
AA Change: D510G

DomainStartEndE-ValueType
Pfam:Glyco_hydro_20 27 220 3.1e-12 PFAM
low complexity region 525 535 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169393
SMART Domains Protein: ENSMUSP00000127260
Gene: ENSMUSG00000039294

DomainStartEndE-ValueType
Pfam:DUF4564 1 51 6.9e-20 PFAM
low complexity region 67 78 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 98.9%
  • 20x: 96.4%
Validation Efficiency 96% (46/48)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik A T 9: 57,258,736 H118Q probably damaging Het
Adgrl3 T G 5: 81,648,713 V623G probably damaging Het
B9d2 A G 7: 25,686,017 D84G probably damaging Het
Clec1a A T 6: 129,428,864 L268H probably damaging Het
Copa A T 1: 172,111,924 N576I possibly damaging Het
Cyp11b1 T C 15: 74,840,949 T88A probably benign Het
Dis3l2 T C 1: 86,857,341 I318T probably benign Het
Dmtf1 T C 5: 9,130,654 probably benign Het
Dnah17 C A 11: 118,041,484 A3639S probably damaging Het
Dnajc8 T A 4: 132,544,720 I89N probably damaging Het
Dync2h1 T A 9: 7,102,549 H377L probably benign Het
Elmsan1 A G 12: 84,156,459 S890P probably damaging Het
Erfe T A 1: 91,370,332 I212N probably benign Het
Fam117b A G 1: 59,952,935 T248A probably damaging Het
Fbxo10 A T 4: 45,044,849 N595K probably damaging Het
Fzd10 T A 5: 128,601,582 M122K probably damaging Het
Gm4070 G A 7: 105,901,980 Q622* probably null Het
Gpr15 C T 16: 58,717,781 R315H probably benign Het
H6pd T C 4: 149,982,051 D626G probably damaging Het
Hoxd4 T C 2: 74,728,492 S220P possibly damaging Het
Invs A G 4: 48,396,260 H311R possibly damaging Het
Ip6k1 A G 9: 108,024,435 T70A probably damaging Het
Lipt2 T C 7: 100,160,371 C222R probably damaging Het
Lrrc3 T A 10: 77,901,032 D190V probably damaging Het
March10 T C 11: 105,389,777 T561A probably benign Het
Mcm10 G A 2: 5,000,935 T463I probably benign Het
Mmel1 T C 4: 154,881,677 L52P probably damaging Het
Nipbl T C 15: 8,303,485 N2218S probably benign Het
Nr4a3 C T 4: 48,051,486 P80L probably benign Het
Nrip1 C T 16: 76,292,588 G694R possibly damaging Het
Oit3 A T 10: 59,435,945 C197S probably damaging Het
Olfr1042 C T 2: 86,159,852 V173M probably benign Het
Olfr904 A G 9: 38,464,247 I69V probably benign Het
Otol1 A G 3: 70,028,100 E475G possibly damaging Het
Pes1 T C 11: 3,973,330 F168L probably damaging Het
Plch1 C T 3: 63,707,734 R780H possibly damaging Het
Pxdn C G 12: 30,015,505 P1275A probably damaging Het
Sgcz T C 8: 37,526,289 E218G probably damaging Het
Slc27a5 A T 7: 12,991,208 N437K probably damaging Het
Sult2b1 A G 7: 45,735,188 S155P probably damaging Het
Tgfbrap1 T C 1: 43,051,896 M690V probably benign Het
Tmem151a A T 19: 5,083,091 L29Q probably damaging Het
Tmprss2 A G 16: 97,568,437 I379T probably damaging Het
Vmn1r168 T A 7: 23,540,898 V60E probably damaging Het
Vmn2r73 A C 7: 85,858,238 V622G probably benign Het
Wdr72 A G 9: 74,210,646 H880R probably benign Het
Zfhx3 A G 8: 108,951,392 T3025A possibly damaging Het
Other mutations in Hexdc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00791:Hexdc APN 11 121221160 missense probably benign 0.35
IGL01981:Hexdc APN 11 121216993 missense possibly damaging 0.93
R0360:Hexdc UTSW 11 121212143 missense probably benign 0.18
R0364:Hexdc UTSW 11 121212143 missense probably benign 0.18
R0376:Hexdc UTSW 11 121218165 splice site probably benign
R1148:Hexdc UTSW 11 121221267 missense probably benign 0.09
R1148:Hexdc UTSW 11 121221267 missense probably benign 0.09
R1493:Hexdc UTSW 11 121221267 missense probably benign 0.09
R1883:Hexdc UTSW 11 121207698 missense probably benign 0.00
R4021:Hexdc UTSW 11 121218161 critical splice donor site probably null
R4163:Hexdc UTSW 11 121221149 missense probably benign 0.01
R4939:Hexdc UTSW 11 121207716 missense probably benign
R5308:Hexdc UTSW 11 121222269 missense probably damaging 1.00
R5716:Hexdc UTSW 11 121221562 missense probably benign 0.03
R6127:Hexdc UTSW 11 121216999 missense possibly damaging 0.89
R6154:Hexdc UTSW 11 121221271 missense probably benign 0.02
R6928:Hexdc UTSW 11 121212054 missense possibly damaging 0.82
R6939:Hexdc UTSW 11 121222338 missense probably benign 0.09
R7125:Hexdc UTSW 11 121204670 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- GAATAATACCAGCTCCAGGGAC -3'
(R):5'- ACAGTTGGAGAGCCTGTCTG -3'

Sequencing Primer
(F):5'- GACTGAGGATATGGGTGTAGC -3'
(R):5'- AACAGAAATCTTGGTGGTGTCC -3'
Posted On2018-11-06