Incidental Mutation 'R6922:Heatr1'
ID539691
Institutional Source Beutler Lab
Gene Symbol Heatr1
Ensembl Gene ENSMUSG00000050244
Gene NameHEAT repeat containing 1
SynonymsB130016L12Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.979) question?
Stock #R6922 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location12395027-12440289 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 12435075 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 1983 (D1983E)
Ref Sequence ENSEMBL: ENSMUSP00000054084 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059270] [ENSMUST00000099820] [ENSMUST00000099821] [ENSMUST00000124888] [ENSMUST00000135166] [ENSMUST00000143693]
Predicted Effect probably benign
Transcript: ENSMUST00000059270
AA Change: D1983E

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000054084
Gene: ENSMUSG00000050244
AA Change: D1983E

DomainStartEndE-ValueType
low complexity region 4 15 N/A INTRINSIC
Pfam:U3snoRNP10 238 354 7e-30 PFAM
SCOP:d1qbkb_ 919 1795 3e-8 SMART
low complexity region 1805 1814 N/A INTRINSIC
BP28CT 1856 2009 2.25e-77 SMART
Blast:BP28CT 2015 2061 2e-15 BLAST
coiled coil region 2109 2137 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099820
SMART Domains Protein: ENSMUSP00000097408
Gene: ENSMUSG00000057554

DomainStartEndE-ValueType
GLECT 16 151 3.05e-50 SMART
Gal-bind_lectin 22 150 7.41e-55 SMART
GLECT 184 316 1.38e-48 SMART
Gal-bind_lectin 190 315 1.28e-49 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000099821
SMART Domains Protein: ENSMUSP00000097409
Gene: ENSMUSG00000057554

DomainStartEndE-ValueType
GLECT 16 151 3.05e-50 SMART
Gal-bind_lectin 22 150 7.41e-55 SMART
GLECT 184 316 1.38e-48 SMART
Gal-bind_lectin 190 315 1.28e-49 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124888
SMART Domains Protein: ENSMUSP00000115094
Gene: ENSMUSG00000057554

DomainStartEndE-ValueType
GLECT 16 151 3.05e-50 SMART
Gal-bind_lectin 22 150 7.41e-55 SMART
GLECT 184 316 1.38e-48 SMART
Gal-bind_lectin 190 315 1.28e-49 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135166
SMART Domains Protein: ENSMUSP00000120210
Gene: ENSMUSG00000057554

DomainStartEndE-ValueType
Pfam:Gal-bind_lectin 1 57 4e-16 PFAM
GLECT 91 223 1.38e-48 SMART
Gal-bind_lectin 97 222 1.28e-49 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000143693
SMART Domains Protein: ENSMUSP00000118925
Gene: ENSMUSG00000057554

DomainStartEndE-ValueType
Pfam:Gal-bind_lectin 1 57 4e-16 PFAM
GLECT 91 223 1.38e-48 SMART
Gal-bind_lectin 97 222 1.28e-49 SMART
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810013L24Rik A G 16: 8,830,689 probably null Het
Ago2 T C 15: 73,113,752 I665V probably benign Het
Arhgap32 A T 9: 32,152,687 M74L possibly damaging Het
Asb4 T C 6: 5,398,304 C90R possibly damaging Het
B3galt4 T A 17: 33,950,847 D139V probably damaging Het
Camta2 A C 11: 70,674,138 I852S probably benign Het
Cox4i2 G T 2: 152,757,095 E57D probably benign Het
Dip2b T C 15: 100,193,843 I1055T probably benign Het
Eif4g3 C T 4: 138,097,335 P284S probably damaging Het
Ephb1 C A 9: 101,929,264 probably null Het
Fbxw7 A T 3: 84,972,416 probably null Het
Frem1 C A 4: 82,922,269 D1789Y probably damaging Het
Gm16368 T A 12: 88,083,832 W46R probably benign Het
Gm29106 A T 1: 118,199,794 R405S probably damaging Het
Gm609 A T 16: 45,443,931 M88K probably benign Het
Greb1l G A 18: 10,547,482 V1567M possibly damaging Het
Lhfpl2 G T 13: 94,174,521 A100S probably damaging Het
Lrp5 A T 19: 3,605,301 V1073D probably damaging Het
Naip6 G A 13: 100,302,198 L364F possibly damaging Het
Nek9 A G 12: 85,303,537 L921P probably damaging Het
Nim1k C T 13: 119,727,727 E49K probably damaging Het
Nsun5 A C 5: 135,370,192 N32T probably damaging Het
Nuggc T C 14: 65,617,643 S325P probably damaging Het
Olfr1135 T A 2: 87,671,453 K305* probably null Het
Olfr716 A G 7: 107,148,083 I256V probably damaging Het
Pcdhga7 A G 18: 37,715,657 D239G probably damaging Het
Pld2 A G 11: 70,553,447 D523G probably benign Het
Prokr1 C A 6: 87,588,473 W130L probably damaging Het
Prpf8 A G 11: 75,490,736 N266S probably damaging Het
Rdh10 T C 1: 16,106,031 V5A probably benign Het
Rp1l1 T C 14: 64,030,385 L1140P possibly damaging Het
Sacs A G 14: 61,211,425 D3640G probably damaging Het
Smarca2 A G 19: 26,691,349 E916G probably damaging Het
Steap3 A T 1: 120,243,894 H160Q probably damaging Het
Svs1 T G 6: 48,987,574 F172C probably damaging Het
Tlk2 T C 11: 105,256,953 probably null Het
Tmprss4 A G 9: 45,185,922 V15A probably benign Het
Togaram2 T C 17: 71,707,134 L559P probably damaging Het
Topbp1 T A 9: 103,335,846 L990H probably damaging Het
Ttll7 A G 3: 146,909,614 T278A possibly damaging Het
Ttn G A 2: 76,774,436 L18385F probably damaging Het
Upf3a G T 8: 13,791,911 A149S probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Zfp316 A T 5: 143,253,525 F913Y probably damaging Het
Other mutations in Heatr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00666:Heatr1 APN 13 12410450 missense probably benign 0.00
IGL00863:Heatr1 APN 13 12435128 missense probably benign 0.02
IGL00899:Heatr1 APN 13 12435176 missense probably benign 0.31
IGL01147:Heatr1 APN 13 12437912 missense probably damaging 0.99
IGL01317:Heatr1 APN 13 12399027 missense probably damaging 1.00
IGL01323:Heatr1 APN 13 12398938 missense possibly damaging 0.86
IGL01625:Heatr1 APN 13 12413528 missense probably damaging 0.98
IGL01973:Heatr1 APN 13 12429799 missense probably benign
IGL02803:Heatr1 APN 13 12433986 missense probably damaging 0.96
IGL02830:Heatr1 APN 13 12426212 missense possibly damaging 0.57
IGL02956:Heatr1 APN 13 12416059 missense possibly damaging 0.53
IGL03000:Heatr1 APN 13 12434411 missense probably damaging 0.99
IGL03024:Heatr1 APN 13 12407509 unclassified probably benign
IGL03035:Heatr1 APN 13 12413219 splice site probably benign
IGL03301:Heatr1 APN 13 12434205 missense probably damaging 1.00
hasan UTSW 13 12417447 splice site probably benign
H8562:Heatr1 UTSW 13 12408713 missense probably benign 0.13
R0226:Heatr1 UTSW 13 12410562 missense probably damaging 1.00
R0571:Heatr1 UTSW 13 12430240 missense probably damaging 0.98
R0722:Heatr1 UTSW 13 12406037 missense probably benign 0.14
R1264:Heatr1 UTSW 13 12424610 unclassified probably benign
R1371:Heatr1 UTSW 13 12417632 missense possibly damaging 0.80
R1388:Heatr1 UTSW 13 12417447 splice site probably benign
R1396:Heatr1 UTSW 13 12406046 missense possibly damaging 0.86
R1519:Heatr1 UTSW 13 12412159 missense probably benign
R1689:Heatr1 UTSW 13 12424625 missense probably benign 0.00
R1696:Heatr1 UTSW 13 12423721 missense possibly damaging 0.96
R1756:Heatr1 UTSW 13 12396460 missense probably benign 0.01
R1859:Heatr1 UTSW 13 12403159 missense probably damaging 1.00
R1932:Heatr1 UTSW 13 12435185 missense probably damaging 1.00
R1957:Heatr1 UTSW 13 12396538 missense probably damaging 1.00
R2018:Heatr1 UTSW 13 12414478 missense possibly damaging 0.68
R2106:Heatr1 UTSW 13 12412058 missense probably benign 0.03
R2119:Heatr1 UTSW 13 12432646 missense probably null 1.00
R2121:Heatr1 UTSW 13 12403264 missense probably benign 0.10
R2122:Heatr1 UTSW 13 12403264 missense probably benign 0.10
R2367:Heatr1 UTSW 13 12433724 missense probably damaging 1.00
R3777:Heatr1 UTSW 13 12413348 missense possibly damaging 0.92
R3783:Heatr1 UTSW 13 12434460 missense probably damaging 1.00
R3784:Heatr1 UTSW 13 12434460 missense probably damaging 1.00
R3786:Heatr1 UTSW 13 12434460 missense probably damaging 1.00
R3787:Heatr1 UTSW 13 12434460 missense probably damaging 1.00
R3843:Heatr1 UTSW 13 12435121 missense probably benign 0.00
R4533:Heatr1 UTSW 13 12434511 missense probably benign 0.05
R4725:Heatr1 UTSW 13 12424662 nonsense probably null
R4763:Heatr1 UTSW 13 12430930 missense possibly damaging 0.65
R4793:Heatr1 UTSW 13 12431837 missense probably benign 0.00
R4797:Heatr1 UTSW 13 12412048 missense probably benign 0.36
R4798:Heatr1 UTSW 13 12412048 missense probably benign 0.36
R4942:Heatr1 UTSW 13 12413510 critical splice acceptor site probably null
R4952:Heatr1 UTSW 13 12410599 missense probably benign 0.38
R4954:Heatr1 UTSW 13 12407516 critical splice acceptor site probably null
R5370:Heatr1 UTSW 13 12401522 missense probably benign 0.02
R5464:Heatr1 UTSW 13 12433643 missense probably benign 0.00
R5483:Heatr1 UTSW 13 12398914 missense probably damaging 1.00
R5497:Heatr1 UTSW 13 12421064 missense possibly damaging 0.93
R5504:Heatr1 UTSW 13 12406619 missense possibly damaging 0.64
R5527:Heatr1 UTSW 13 12402760 missense probably damaging 1.00
R5527:Heatr1 UTSW 13 12404948 missense probably benign
R5836:Heatr1 UTSW 13 12408736 missense probably damaging 0.99
R5916:Heatr1 UTSW 13 12434471 missense probably damaging 1.00
R6018:Heatr1 UTSW 13 12404947 missense probably benign
R6018:Heatr1 UTSW 13 12406058 missense probably benign 0.26
R6216:Heatr1 UTSW 13 12432664 missense probably benign 0.16
R6396:Heatr1 UTSW 13 12406097 missense possibly damaging 0.86
R6472:Heatr1 UTSW 13 12434230 missense probably benign 0.29
R7077:Heatr1 UTSW 13 12418164 missense possibly damaging 0.63
R7297:Heatr1 UTSW 13 12421060 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TAAAGGAGAGCCCCATCTGTG -3'
(R):5'- CACTGTATGACTAAGCCTTGTAAGC -3'

Sequencing Primer
(F):5'- CATCTGTGGACACCATTGTTTG -3'
(R):5'- AGCCTTGTAAGCTATCATGTCAC -3'
Posted On2018-11-06