Incidental Mutation 'R6923:Orc2'
ID539709
Institutional Source Beutler Lab
Gene Symbol Orc2
Ensembl Gene ENSMUSG00000026037
Gene Nameorigin recognition complex, subunit 2
SynonymsOrc2l
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.913) question?
Stock #R6923 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location58462771-58505109 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 58500375 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Serine at position 35 (L35S)
Ref Sequence ENSEMBL: ENSMUSP00000141138 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027198] [ENSMUST00000114325] [ENSMUST00000190695] [ENSMUST00000191206]
Predicted Effect probably benign
Transcript: ENSMUST00000027198
AA Change: L35S

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000027198
Gene: ENSMUSG00000026037
AA Change: L35S

DomainStartEndE-ValueType
low complexity region 176 201 N/A INTRINSIC
Pfam:ORC2 254 563 2.5e-110 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114325
SMART Domains Protein: ENSMUSP00000109964
Gene: ENSMUSG00000026037

DomainStartEndE-ValueType
low complexity region 128 153 N/A INTRINSIC
Pfam:ORC2 206 517 1.2e-108 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000190695
Predicted Effect probably benign
Transcript: ENSMUST00000191206
AA Change: L35S

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.4%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The origin recognition complex (ORC) is a highly conserved six subunits protein complex essential for the initiation of the DNA replication in eukaryotic cells. Studies in yeast demonstrated that ORC binds specifically to origins of replication and serves as a platform for the assembly of additional initiation factors such as Cdc6 and Mcm proteins. The protein encoded by this gene is a subunit of the ORC complex. This protein forms a core complex with ORC3, -4, and -5. It also interacts with CDC45 and MCM10, which are proteins known to be important for the initiation of DNA replication. This protein has been demonstrated to specifically associate with the origin of replication of Epstein-Barr virus in human cells, and is thought to be required for DNA replication from viral origin of replication. Alternatively spliced transcript variants have been found, one of which is a nonsense-mediated mRNA decay candidate. [provided by RefSeq, Oct 2010]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T A 11: 78,274,626 S1323T possibly damaging Het
4930444G20Rik C A 10: 22,067,755 G109C probably damaging Het
5830473C10Rik A G 5: 90,577,793 N288S probably benign Het
Ap4b1 T A 3: 103,812,214 D81E probably benign Het
Atg16l1 A T 1: 87,774,356 probably null Het
Atp11a A G 8: 12,856,949 T459A probably damaging Het
AU019823 T A 9: 50,610,310 I104L probably benign Het
BC049762 C T 11: 51,253,981 D158N probably damaging Het
BC055324 A G 1: 163,986,885 probably null Het
Bloc1s5 T A 13: 38,631,064 I40F probably damaging Het
Capn5 T A 7: 98,129,254 Q386L probably damaging Het
Cbfa2t2 C T 2: 154,534,983 H529Y probably damaging Het
Cd3d T C 9: 44,985,859 probably benign Het
Cenpa A G 5: 30,672,462 probably null Het
Chit1 A T 1: 134,149,425 Y322F probably null Het
Cntnap5c T A 17: 58,092,350 N399K possibly damaging Het
Dock8 A T 19: 25,095,606 T417S probably benign Het
Fkbp2 A G 19: 6,979,169 Het
Fsip1 G A 2: 118,249,913 R121C probably benign Het
Gbp2b T C 3: 142,600,559 I131T probably benign Het
Gm10093 A G 17: 78,492,914 T445A possibly damaging Het
Gm12695 T C 4: 96,769,816 N39D probably benign Het
Gm13089 A T 4: 143,699,106 I89N probably benign Het
Gm4922 T C 10: 18,783,868 R369G probably damaging Het
Gpatch3 C T 4: 133,582,525 L390F probably damaging Het
Gpd2 G A 2: 57,355,788 M443I probably damaging Het
Gpt2 G A 8: 85,518,052 E325K probably benign Het
Jph3 A G 8: 121,753,371 T263A possibly damaging Het
Me3 C A 7: 89,845,885 A337E probably damaging Het
Mndal A C 1: 173,884,698 probably null Het
Muc6 C T 7: 141,637,540 E2342K possibly damaging Het
Neb A G 2: 52,186,064 V5659A probably damaging Het
Nrxn1 G A 17: 91,088,233 A165V probably benign Het
Olfr1442 T A 19: 12,675,045 I280N possibly damaging Het
Olfr1447 T C 19: 12,901,312 N156S probably benign Het
Pax4 A G 6: 28,447,119 probably null Het
Pcdhb7 C T 18: 37,342,469 probably null Het
Pla2r1 C T 2: 60,514,966 E349K probably benign Het
Polr2a C T 11: 69,735,961 A1516T probably benign Het
Prpf38a G T 4: 108,570,204 D187E possibly damaging Het
Rdh16f1 T A 10: 127,788,868 probably null Het
S100z T A 13: 95,478,582 D25V probably damaging Het
Scamp2 T G 9: 57,581,612 F199V probably damaging Het
Senp2 T G 16: 22,011,576 probably benign Het
Sltm T A 9: 70,574,610 S365T probably damaging Het
Smg6 C G 11: 74,929,343 P147A possibly damaging Het
Spem2 T A 11: 69,817,777 R121W probably damaging Het
Sufu A G 19: 46,450,966 probably null Het
Syt2 T C 1: 134,746,763 V313A possibly damaging Het
Tet2 C T 3: 133,479,341 probably null Het
Tfeb T A 17: 47,786,983 I232N probably benign Het
Ticrr T G 7: 79,691,853 I1062M probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vrk2 G A 11: 26,489,893 A226V probably damaging Het
Wnk1 A T 6: 119,965,678 probably benign Het
Xpo4 G T 14: 57,603,711 T505K probably benign Het
Yy1 A T 12: 108,793,668 I86F probably benign Het
Zc3h15 A G 2: 83,657,056 D73G possibly damaging Het
Other mutations in Orc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00434:Orc2 APN 1 58493716 missense possibly damaging 0.81
IGL00549:Orc2 APN 1 58481042 missense probably benign 0.00
IGL01343:Orc2 APN 1 58492855 critical splice donor site probably null
IGL01357:Orc2 APN 1 58497392 missense probably benign 0.26
IGL01357:Orc2 APN 1 58497393 missense probably benign 0.00
IGL02167:Orc2 APN 1 58483639 unclassified probably benign
IGL02343:Orc2 APN 1 58469666 critical splice donor site probably null
IGL02548:Orc2 APN 1 58466122 unclassified probably benign
R0557:Orc2 UTSW 1 58469687 missense probably damaging 1.00
R1470:Orc2 UTSW 1 58481158 unclassified probably benign
R1886:Orc2 UTSW 1 58471088 critical splice acceptor site probably null
R2065:Orc2 UTSW 1 58469695 missense probably damaging 1.00
R3848:Orc2 UTSW 1 58480992 missense probably benign 0.08
R4389:Orc2 UTSW 1 58474861 missense probably benign 0.21
R4393:Orc2 UTSW 1 58467650 critical splice donor site probably null
R4613:Orc2 UTSW 1 58500309 nonsense probably null
R5183:Orc2 UTSW 1 58474818 missense possibly damaging 0.83
R5652:Orc2 UTSW 1 58466072 missense probably damaging 0.99
R5793:Orc2 UTSW 1 58497388 start codon destroyed probably null 0.27
R5997:Orc2 UTSW 1 58472388 missense probably damaging 1.00
R6007:Orc2 UTSW 1 58467692 missense probably benign 0.03
R6330:Orc2 UTSW 1 58500334 missense probably benign
R6656:Orc2 UTSW 1 58493659 critical splice donor site probably null
R6934:Orc2 UTSW 1 58500364 missense probably benign 0.28
Z1088:Orc2 UTSW 1 58476516 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTCACGTTACTAGCCGAAAGC -3'
(R):5'- TACTGACCCTGCGTTTAGTG -3'

Sequencing Primer
(F):5'- CGAAAGCTGGGTGTGTGTCAC -3'
(R):5'- CATGTAATATGCACATGGTGGTCAG -3'
Posted On2018-11-06