Incidental Mutation 'R6923:Pla2r1'
ID539717
Institutional Source Beutler Lab
Gene Symbol Pla2r1
Ensembl Gene ENSMUSG00000054580
Gene Namephospholipase A2 receptor 1
SynonymsM-type receptor, Pla2g1br, PLA2-I receptor
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6923 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location60417543-60553308 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 60514966 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 349 (E349K)
Ref Sequence ENSEMBL: ENSMUSP00000108144 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112525]
Predicted Effect probably benign
Transcript: ENSMUST00000112525
AA Change: E349K

PolyPhen 2 Score 0.114 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000108144
Gene: ENSMUSG00000054580
AA Change: E349K

DomainStartEndE-ValueType
low complexity region 35 62 N/A INTRINSIC
RICIN 77 189 2.98e-16 SMART
FN2 209 257 1.17e-25 SMART
CLECT 267 392 7.66e-30 SMART
CLECT 415 539 1.88e-29 SMART
CLECT 552 679 5.42e-21 SMART
CLECT 699 832 3.58e-21 SMART
CLECT 847 973 7.55e-20 SMART
CLECT 992 1131 5.05e-30 SMART
CLECT 1148 1267 4.72e-21 SMART
CLECT 1281 1412 1.44e-25 SMART
transmembrane domain 1432 1454 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.4%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene represents a phospholipase A2 receptor. The encoded protein likely exists as both a transmembrane form and a soluble form. The transmembrane receptor may play a role in clearance of phospholipase A2, thereby inhibiting its action. Polymorphisms at this locus have been associated with susceptibility to idiopathic membranous nephropathy. Alternatively spliced transcript variants encoding different isoforms have been identified.[provided by RefSeq, Sep 2010]
PHENOTYPE: Homozygous null mice are viable and fertile with no overt abnormalities. These mice are more resistant to toxic effects of lipopolysaccharide than controls, suggesting a role for this gene in the progression of endotoxic shock. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T A 11: 78,274,626 S1323T possibly damaging Het
4930444G20Rik C A 10: 22,067,755 G109C probably damaging Het
5830473C10Rik A G 5: 90,577,793 N288S probably benign Het
Ap4b1 T A 3: 103,812,214 D81E probably benign Het
Atg16l1 A T 1: 87,774,356 probably null Het
Atp11a A G 8: 12,856,949 T459A probably damaging Het
AU019823 T A 9: 50,610,310 I104L probably benign Het
BC049762 C T 11: 51,253,981 D158N probably damaging Het
BC055324 A G 1: 163,986,885 probably null Het
Bloc1s5 T A 13: 38,631,064 I40F probably damaging Het
Capn5 T A 7: 98,129,254 Q386L probably damaging Het
Cbfa2t2 C T 2: 154,534,983 H529Y probably damaging Het
Cd3d T C 9: 44,985,859 probably benign Het
Cenpa A G 5: 30,672,462 probably null Het
Chit1 A T 1: 134,149,425 Y322F probably null Het
Cntnap5c T A 17: 58,092,350 N399K possibly damaging Het
Dock8 A T 19: 25,095,606 T417S probably benign Het
Fkbp2 A G 19: 6,979,169 Het
Fsip1 G A 2: 118,249,913 R121C probably benign Het
Gbp2b T C 3: 142,600,559 I131T probably benign Het
Gm10093 A G 17: 78,492,914 T445A possibly damaging Het
Gm12695 T C 4: 96,769,816 N39D probably benign Het
Gm13089 A T 4: 143,699,106 I89N probably benign Het
Gm4922 T C 10: 18,783,868 R369G probably damaging Het
Gpatch3 C T 4: 133,582,525 L390F probably damaging Het
Gpd2 G A 2: 57,355,788 M443I probably damaging Het
Gpt2 G A 8: 85,518,052 E325K probably benign Het
Jph3 A G 8: 121,753,371 T263A possibly damaging Het
Me3 C A 7: 89,845,885 A337E probably damaging Het
Mndal A C 1: 173,884,698 probably null Het
Muc6 C T 7: 141,637,540 E2342K possibly damaging Het
Neb A G 2: 52,186,064 V5659A probably damaging Het
Nrxn1 G A 17: 91,088,233 A165V probably benign Het
Olfr1442 T A 19: 12,675,045 I280N possibly damaging Het
Olfr1447 T C 19: 12,901,312 N156S probably benign Het
Orc2 A G 1: 58,500,375 L35S probably benign Het
Pax4 A G 6: 28,447,119 probably null Het
Pcdhb7 C T 18: 37,342,469 probably null Het
Polr2a C T 11: 69,735,961 A1516T probably benign Het
Prpf38a G T 4: 108,570,204 D187E possibly damaging Het
Rdh16f1 T A 10: 127,788,868 probably null Het
S100z T A 13: 95,478,582 D25V probably damaging Het
Scamp2 T G 9: 57,581,612 F199V probably damaging Het
Senp2 T G 16: 22,011,576 probably benign Het
Sltm T A 9: 70,574,610 S365T probably damaging Het
Smg6 C G 11: 74,929,343 P147A possibly damaging Het
Spem2 T A 11: 69,817,777 R121W probably damaging Het
Sufu A G 19: 46,450,966 probably null Het
Syt2 T C 1: 134,746,763 V313A possibly damaging Het
Tet2 C T 3: 133,479,341 probably null Het
Tfeb T A 17: 47,786,983 I232N probably benign Het
Ticrr T G 7: 79,691,853 I1062M probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vrk2 G A 11: 26,489,893 A226V probably damaging Het
Wnk1 A T 6: 119,965,678 probably benign Het
Xpo4 G T 14: 57,603,711 T505K probably benign Het
Yy1 A T 12: 108,793,668 I86F probably benign Het
Zc3h15 A G 2: 83,657,056 D73G possibly damaging Het
Other mutations in Pla2r1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00569:Pla2r1 APN 2 60420425 missense probably benign
IGL00886:Pla2r1 APN 2 60424324 missense probably damaging 1.00
IGL00928:Pla2r1 APN 2 60535080 missense probably damaging 0.99
IGL01361:Pla2r1 APN 2 60479470 missense probably damaging 1.00
IGL01403:Pla2r1 APN 2 60424288 missense probably damaging 0.99
IGL01475:Pla2r1 APN 2 60441081 splice site probably benign
IGL01517:Pla2r1 APN 2 60504253 missense probably damaging 1.00
IGL01646:Pla2r1 APN 2 60495364 missense probably damaging 1.00
IGL02208:Pla2r1 APN 2 60428588 missense possibly damaging 0.81
IGL02301:Pla2r1 APN 2 60452436 missense probably benign 0.01
IGL02522:Pla2r1 APN 2 60428669 missense probably benign 0.11
IGL02688:Pla2r1 APN 2 60455201 missense probably damaging 1.00
IGL02822:Pla2r1 APN 2 60455173 missense probably damaging 1.00
IGL02850:Pla2r1 APN 2 60502069 missense probably benign 0.03
IGL03233:Pla2r1 APN 2 60428580 missense possibly damaging 0.63
IGL03350:Pla2r1 APN 2 60455173 missense probably damaging 1.00
IGL02980:Pla2r1 UTSW 2 60515046 missense possibly damaging 0.77
R0105:Pla2r1 UTSW 2 60514981 missense possibly damaging 0.89
R0105:Pla2r1 UTSW 2 60514981 missense possibly damaging 0.89
R0387:Pla2r1 UTSW 2 60432601 missense probably benign 0.03
R0522:Pla2r1 UTSW 2 60479515 missense probably benign 0.01
R0550:Pla2r1 UTSW 2 60425350 critical splice donor site probably null
R0718:Pla2r1 UTSW 2 60479530 missense possibly damaging 0.55
R0906:Pla2r1 UTSW 2 60514947 missense possibly damaging 0.79
R0945:Pla2r1 UTSW 2 60458410 missense possibly damaging 0.89
R1229:Pla2r1 UTSW 2 60534762 missense probably benign 0.09
R1397:Pla2r1 UTSW 2 60534762 missense probably benign 0.09
R1667:Pla2r1 UTSW 2 60420257 missense probably benign 0.00
R1668:Pla2r1 UTSW 2 60428646 missense probably damaging 0.99
R1694:Pla2r1 UTSW 2 60441084 critical splice donor site probably null
R1864:Pla2r1 UTSW 2 60428711 missense probably benign 0.01
R2029:Pla2r1 UTSW 2 60431973 missense probably damaging 0.99
R2035:Pla2r1 UTSW 2 60422736 missense probably damaging 1.00
R2207:Pla2r1 UTSW 2 60458435 missense probably damaging 1.00
R2429:Pla2r1 UTSW 2 60514968 missense probably damaging 1.00
R3196:Pla2r1 UTSW 2 60522783 missense probably damaging 1.00
R3522:Pla2r1 UTSW 2 60448906 missense probably damaging 1.00
R3973:Pla2r1 UTSW 2 60448962 missense probably benign 0.30
R4006:Pla2r1 UTSW 2 60522873 missense probably damaging 1.00
R4091:Pla2r1 UTSW 2 60432593 missense probably damaging 1.00
R4158:Pla2r1 UTSW 2 60422622 missense probably damaging 0.97
R4160:Pla2r1 UTSW 2 60422622 missense probably damaging 0.97
R4168:Pla2r1 UTSW 2 60497614 nonsense probably null
R4541:Pla2r1 UTSW 2 60427738 missense probably damaging 1.00
R4712:Pla2r1 UTSW 2 60428650 missense probably damaging 1.00
R4797:Pla2r1 UTSW 2 60504180 missense possibly damaging 0.47
R4884:Pla2r1 UTSW 2 60534984 missense probably damaging 1.00
R4923:Pla2r1 UTSW 2 60422712 missense probably benign 0.31
R5017:Pla2r1 UTSW 2 60522760 splice site probably null
R5116:Pla2r1 UTSW 2 60448906 missense probably damaging 1.00
R5641:Pla2r1 UTSW 2 60514984 missense probably damaging 1.00
R5807:Pla2r1 UTSW 2 60428721 missense possibly damaging 0.78
R5898:Pla2r1 UTSW 2 60422760 missense probably damaging 1.00
R6241:Pla2r1 UTSW 2 60502199 splice site probably null
R7020:Pla2r1 UTSW 2 60447399 missense possibly damaging 0.79
R7028:Pla2r1 UTSW 2 60458393 missense probably damaging 0.98
R7257:Pla2r1 UTSW 2 60427625 critical splice donor site probably null
R7291:Pla2r1 UTSW 2 60530435 missense probably benign 0.43
Predicted Primers PCR Primer
(F):5'- GCATGGTACTTCAGGATGGC -3'
(R):5'- ACAATTATAGTGAGTGTCCTGTAGG -3'

Sequencing Primer
(F):5'- ATGGCCGGGGTCACTTACAC -3'
(R):5'- TGTAGGGGGCGCTACAG -3'
Posted On2018-11-06