Incidental Mutation 'R6923:Ap4b1'
ID539721
Institutional Source Beutler Lab
Gene Symbol Ap4b1
Ensembl Gene ENSMUSG00000032952
Gene Nameadaptor-related protein complex AP-4, beta 1
SynonymsAP-4 beta-4, 1810038H16Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.342) question?
Stock #R6923 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location103809520-103822025 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 103812214 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 81 (D81E)
Ref Sequence ENSEMBL: ENSMUSP00000075904 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029435] [ENSMUST00000047285] [ENSMUST00000063502] [ENSMUST00000076599] [ENSMUST00000106823] [ENSMUST00000106824] [ENSMUST00000106832] [ENSMUST00000106834] [ENSMUST00000128716] [ENSMUST00000198752] [ENSMUST00000199710] [ENSMUST00000200377]
Predicted Effect probably benign
Transcript: ENSMUST00000029435
SMART Domains Protein: ENSMUSP00000029435
Gene: ENSMUSG00000027845

DomainStartEndE-ValueType
Lactamase_B 1 175 2.06e0 SMART
Pfam:DRMBL 215 301 1e-13 PFAM
PDB:3BUA|H 492 526 1e-10 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000047285
AA Change: D81E

PolyPhen 2 Score 0.193 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000044262
Gene: ENSMUSG00000032952
AA Change: D81E

DomainStartEndE-ValueType
Pfam:Adaptin_N 6 525 7e-94 PFAM
Pfam:Cnd1 98 269 2.4e-11 PFAM
B2-adapt-app_C 619 731 3.75e-42 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000063502
SMART Domains Protein: ENSMUSP00000067695
Gene: ENSMUSG00000027845

DomainStartEndE-ValueType
Blast:Lactamase_B 1 49 4e-24 BLAST
Pfam:DRMBL 89 176 7.4e-20 PFAM
PDB:3BUA|H 366 400 8e-11 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000076599
AA Change: D81E

PolyPhen 2 Score 0.193 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000075904
Gene: ENSMUSG00000032952
AA Change: D81E

DomainStartEndE-ValueType
Pfam:Adaptin_N 6 525 1e-93 PFAM
Pfam:Cnd1 98 286 3.9e-10 PFAM
B2-adapt-app_C 619 731 3.75e-42 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106823
AA Change: D81E

PolyPhen 2 Score 0.091 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000102436
Gene: ENSMUSG00000032952
AA Change: D81E

DomainStartEndE-ValueType
Pfam:Adaptin_N 6 374 2e-68 PFAM
Pfam:Cnd1 98 285 1.4e-10 PFAM
Pfam:Adaptin_N 371 497 5.2e-16 PFAM
B2-adapt-app_C 591 703 3.75e-42 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106824
SMART Domains Protein: ENSMUSP00000102437
Gene: ENSMUSG00000032952

DomainStartEndE-ValueType
Pfam:Cnd1 35 212 5e-9 PFAM
Pfam:Adaptin_N 35 450 1.2e-62 PFAM
B2-adapt-app_C 544 656 3.75e-42 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106832
SMART Domains Protein: ENSMUSP00000102445
Gene: ENSMUSG00000027845

DomainStartEndE-ValueType
Lactamase_B 1 175 2.06e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106834
SMART Domains Protein: ENSMUSP00000102447
Gene: ENSMUSG00000027845

DomainStartEndE-ValueType
Lactamase_B 1 175 2.06e0 SMART
Pfam:DRMBL 215 302 7.9e-20 PFAM
PDB:3BUA|H 492 526 1e-10 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000128716
SMART Domains Protein: ENSMUSP00000121063
Gene: ENSMUSG00000027845

DomainStartEndE-ValueType
Blast:Lactamase_B 1 63 3e-40 BLAST
PDB:3ZDK|A 1 63 3e-34 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000198752
SMART Domains Protein: ENSMUSP00000143067
Gene: ENSMUSG00000027845

DomainStartEndE-ValueType
Blast:Lactamase_B 1 93 2e-64 BLAST
PDB:3ZDK|A 1 97 1e-62 PDB
SCOP:d1a7ta_ 3 93 5e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000199686
Predicted Effect probably benign
Transcript: ENSMUST00000199710
SMART Domains Protein: ENSMUSP00000143463
Gene: ENSMUSG00000105053

DomainStartEndE-ValueType
Pfam:Cnd1 35 212 5e-9 PFAM
Pfam:Adaptin_N 35 450 1.2e-62 PFAM
B2-adapt-app_C 544 656 3.75e-42 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000200377
SMART Domains Protein: ENSMUSP00000143355
Gene: ENSMUSG00000032952

DomainStartEndE-ValueType
Pfam:Adaptin_N 7 357 2.9e-45 PFAM
B2-adapt-app_C 451 563 2.8e-46 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.4%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of a heterotetrameric adapter-like complex 4 that is involved in targeting proteins from the trans-Golgi network to the endosomal-lysosomal system. Mutations in this gene are associated with cerebral palsy spastic quadriplegic type 5 (CPSQ5) disorder. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit poor rotarod performance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T A 11: 78,274,626 S1323T possibly damaging Het
4930444G20Rik C A 10: 22,067,755 G109C probably damaging Het
5830473C10Rik A G 5: 90,577,793 N288S probably benign Het
Atg16l1 A T 1: 87,774,356 probably null Het
Atp11a A G 8: 12,856,949 T459A probably damaging Het
AU019823 T A 9: 50,610,310 I104L probably benign Het
BC049762 C T 11: 51,253,981 D158N probably damaging Het
BC055324 A G 1: 163,986,885 probably null Het
Bloc1s5 T A 13: 38,631,064 I40F probably damaging Het
Capn5 T A 7: 98,129,254 Q386L probably damaging Het
Cbfa2t2 C T 2: 154,534,983 H529Y probably damaging Het
Cd3d T C 9: 44,985,859 probably benign Het
Cenpa A G 5: 30,672,462 probably null Het
Chit1 A T 1: 134,149,425 Y322F probably null Het
Cntnap5c T A 17: 58,092,350 N399K possibly damaging Het
Dock8 A T 19: 25,095,606 T417S probably benign Het
Fkbp2 A G 19: 6,979,169 Het
Fsip1 G A 2: 118,249,913 R121C probably benign Het
Gbp2b T C 3: 142,600,559 I131T probably benign Het
Gm10093 A G 17: 78,492,914 T445A possibly damaging Het
Gm12695 T C 4: 96,769,816 N39D probably benign Het
Gm13089 A T 4: 143,699,106 I89N probably benign Het
Gm4922 T C 10: 18,783,868 R369G probably damaging Het
Gpatch3 C T 4: 133,582,525 L390F probably damaging Het
Gpd2 G A 2: 57,355,788 M443I probably damaging Het
Gpt2 G A 8: 85,518,052 E325K probably benign Het
Jph3 A G 8: 121,753,371 T263A possibly damaging Het
Me3 C A 7: 89,845,885 A337E probably damaging Het
Mndal A C 1: 173,884,698 probably null Het
Muc6 C T 7: 141,637,540 E2342K possibly damaging Het
Neb A G 2: 52,186,064 V5659A probably damaging Het
Nrxn1 G A 17: 91,088,233 A165V probably benign Het
Olfr1442 T A 19: 12,675,045 I280N possibly damaging Het
Olfr1447 T C 19: 12,901,312 N156S probably benign Het
Orc2 A G 1: 58,500,375 L35S probably benign Het
Pax4 A G 6: 28,447,119 probably null Het
Pcdhb7 C T 18: 37,342,469 probably null Het
Pla2r1 C T 2: 60,514,966 E349K probably benign Het
Polr2a C T 11: 69,735,961 A1516T probably benign Het
Prpf38a G T 4: 108,570,204 D187E possibly damaging Het
Rdh16f1 T A 10: 127,788,868 probably null Het
S100z T A 13: 95,478,582 D25V probably damaging Het
Scamp2 T G 9: 57,581,612 F199V probably damaging Het
Senp2 T G 16: 22,011,576 probably benign Het
Sltm T A 9: 70,574,610 S365T probably damaging Het
Smg6 C G 11: 74,929,343 P147A possibly damaging Het
Spem2 T A 11: 69,817,777 R121W probably damaging Het
Sufu A G 19: 46,450,966 probably null Het
Syt2 T C 1: 134,746,763 V313A possibly damaging Het
Tet2 C T 3: 133,479,341 probably null Het
Tfeb T A 17: 47,786,983 I232N probably benign Het
Ticrr T G 7: 79,691,853 I1062M probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vrk2 G A 11: 26,489,893 A226V probably damaging Het
Wnk1 A T 6: 119,965,678 probably benign Het
Xpo4 G T 14: 57,603,711 T505K probably benign Het
Yy1 A T 12: 108,793,668 I86F probably benign Het
Zc3h15 A G 2: 83,657,056 D73G possibly damaging Het
Other mutations in Ap4b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00391:Ap4b1 APN 3 103821542 missense probably benign 0.19
IGL01545:Ap4b1 APN 3 103812827 missense probably benign 0.02
IGL02422:Ap4b1 APN 3 103812854 missense possibly damaging 0.95
IGL02525:Ap4b1 APN 3 103812848 missense probably damaging 1.00
R0035:Ap4b1 UTSW 3 103820664 splice site probably benign
R0035:Ap4b1 UTSW 3 103820664 splice site probably benign
R0086:Ap4b1 UTSW 3 103814860 missense probably damaging 0.99
R0090:Ap4b1 UTSW 3 103820429 missense possibly damaging 0.91
R0136:Ap4b1 UTSW 3 103809946 start codon destroyed probably null 1.00
R0299:Ap4b1 UTSW 3 103809946 start codon destroyed probably null 1.00
R0403:Ap4b1 UTSW 3 103818839 missense probably damaging 0.99
R0403:Ap4b1 UTSW 3 103821396 missense probably benign 0.00
R1283:Ap4b1 UTSW 3 103818861 missense probably damaging 1.00
R1673:Ap4b1 UTSW 3 103817845 critical splice donor site probably null
R1797:Ap4b1 UTSW 3 103818833 missense possibly damaging 0.92
R1869:Ap4b1 UTSW 3 103820868 nonsense probably null
R2925:Ap4b1 UTSW 3 103820681 missense probably damaging 1.00
R3905:Ap4b1 UTSW 3 103818893 missense possibly damaging 0.94
R4079:Ap4b1 UTSW 3 103813378 missense probably damaging 1.00
R4645:Ap4b1 UTSW 3 103821449 missense probably benign 0.32
R4786:Ap4b1 UTSW 3 103818804 missense probably benign 0.00
R5824:Ap4b1 UTSW 3 103813385 missense probably benign 0.30
R6342:Ap4b1 UTSW 3 103813368 missense possibly damaging 0.60
R6826:Ap4b1 UTSW 3 103812908 critical splice donor site probably null
R6974:Ap4b1 UTSW 3 103813285 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TAGCTAGCCAGAGCACATGTAAATAC -3'
(R):5'- AGGAACTTAAGCTGTCCTCACTAC -3'

Sequencing Primer
(F):5'- ACAACTCTTCCTACAGATTGGG -3'
(R):5'- TAAGCTGTCCTCACTACAAATCTG -3'
Posted On2018-11-06