Incidental Mutation 'R6923:Ticrr'
ID539732
Institutional Source Beutler Lab
Gene Symbol Ticrr
Ensembl Gene ENSMUSG00000046591
Gene NameTOPBP1-interacting checkpoint and replication regulator
Synonyms5730590G19Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.967) question?
Stock #R6923 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location79660196-79698148 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 79691853 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 1062 (I1062M)
Ref Sequence ENSEMBL: ENSMUSP00000041377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035977] [ENSMUST00000206591] [ENSMUST00000206622]
Predicted Effect probably damaging
Transcript: ENSMUST00000035977
AA Change: I1062M

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000041377
Gene: ENSMUSG00000046591
AA Change: I1062M

DomainStartEndE-ValueType
low complexity region 23 31 N/A INTRINSIC
Pfam:Treslin_N 211 1005 N/A PFAM
low complexity region 1186 1197 N/A INTRINSIC
low complexity region 1220 1235 N/A INTRINSIC
low complexity region 1339 1359 N/A INTRINSIC
low complexity region 1472 1480 N/A INTRINSIC
low complexity region 1496 1514 N/A INTRINSIC
low complexity region 1630 1643 N/A INTRINSIC
low complexity region 1694 1707 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000206591
Predicted Effect probably benign
Transcript: ENSMUST00000206622
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.4%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Treslin is involved in the initiation of DNA replication (Kumagai et al., 2010 [PubMed 20116089]).[supplied by OMIM, Apr 2010]
PHENOTYPE: Mice homozygous for an ENU-induced allele are mostly hairless, with only a light patch of hair around the face and tail. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T A 11: 78,274,626 S1323T possibly damaging Het
4930444G20Rik C A 10: 22,067,755 G109C probably damaging Het
5830473C10Rik A G 5: 90,577,793 N288S probably benign Het
Ap4b1 T A 3: 103,812,214 D81E probably benign Het
Atg16l1 A T 1: 87,774,356 probably null Het
Atp11a A G 8: 12,856,949 T459A probably damaging Het
AU019823 T A 9: 50,610,310 I104L probably benign Het
BC049762 C T 11: 51,253,981 D158N probably damaging Het
BC055324 A G 1: 163,986,885 probably null Het
Bloc1s5 T A 13: 38,631,064 I40F probably damaging Het
Capn5 T A 7: 98,129,254 Q386L probably damaging Het
Cbfa2t2 C T 2: 154,534,983 H529Y probably damaging Het
Cd3d T C 9: 44,985,859 probably benign Het
Cenpa A G 5: 30,672,462 probably null Het
Chit1 A T 1: 134,149,425 Y322F probably null Het
Cntnap5c T A 17: 58,092,350 N399K possibly damaging Het
Dock8 A T 19: 25,095,606 T417S probably benign Het
Fkbp2 A G 19: 6,979,169 Het
Fsip1 G A 2: 118,249,913 R121C probably benign Het
Gbp2b T C 3: 142,600,559 I131T probably benign Het
Gm10093 A G 17: 78,492,914 T445A possibly damaging Het
Gm12695 T C 4: 96,769,816 N39D probably benign Het
Gm13089 A T 4: 143,699,106 I89N probably benign Het
Gm4922 T C 10: 18,783,868 R369G probably damaging Het
Gpatch3 C T 4: 133,582,525 L390F probably damaging Het
Gpd2 G A 2: 57,355,788 M443I probably damaging Het
Gpt2 G A 8: 85,518,052 E325K probably benign Het
Jph3 A G 8: 121,753,371 T263A possibly damaging Het
Me3 C A 7: 89,845,885 A337E probably damaging Het
Mndal A C 1: 173,884,698 probably null Het
Muc6 C T 7: 141,637,540 E2342K possibly damaging Het
Neb A G 2: 52,186,064 V5659A probably damaging Het
Nrxn1 G A 17: 91,088,233 A165V probably benign Het
Olfr1442 T A 19: 12,675,045 I280N possibly damaging Het
Olfr1447 T C 19: 12,901,312 N156S probably benign Het
Orc2 A G 1: 58,500,375 L35S probably benign Het
Pax4 A G 6: 28,447,119 probably null Het
Pcdhb7 C T 18: 37,342,469 probably null Het
Pla2r1 C T 2: 60,514,966 E349K probably benign Het
Polr2a C T 11: 69,735,961 A1516T probably benign Het
Prpf38a G T 4: 108,570,204 D187E possibly damaging Het
Rdh16f1 T A 10: 127,788,868 probably null Het
S100z T A 13: 95,478,582 D25V probably damaging Het
Scamp2 T G 9: 57,581,612 F199V probably damaging Het
Senp2 T G 16: 22,011,576 probably benign Het
Sltm T A 9: 70,574,610 S365T probably damaging Het
Smg6 C G 11: 74,929,343 P147A possibly damaging Het
Spem2 T A 11: 69,817,777 R121W probably damaging Het
Sufu A G 19: 46,450,966 probably null Het
Syt2 T C 1: 134,746,763 V313A possibly damaging Het
Tet2 C T 3: 133,479,341 probably null Het
Tfeb T A 17: 47,786,983 I232N probably benign Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vrk2 G A 11: 26,489,893 A226V probably damaging Het
Wnk1 A T 6: 119,965,678 probably benign Het
Xpo4 G T 14: 57,603,711 T505K probably benign Het
Yy1 A T 12: 108,793,668 I86F probably benign Het
Zc3h15 A G 2: 83,657,056 D73G possibly damaging Het
Other mutations in Ticrr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Ticrr APN 7 79677283 missense probably damaging 1.00
IGL00596:Ticrr APN 7 79677293 missense probably damaging 1.00
IGL01327:Ticrr APN 7 79694461 missense probably benign 0.00
IGL01525:Ticrr APN 7 79682449 missense probably damaging 1.00
IGL01565:Ticrr APN 7 79694548 missense probably benign
IGL01936:Ticrr APN 7 79694549 missense probably benign 0.11
IGL02160:Ticrr APN 7 79694019 missense probably benign 0.29
IGL02246:Ticrr APN 7 79675328 missense probably damaging 1.00
IGL02487:Ticrr APN 7 79683021 missense possibly damaging 0.86
IGL02593:Ticrr APN 7 79695466 missense probably damaging 0.99
IGL02970:Ticrr APN 7 79695171 missense probably benign 0.01
FR4304:Ticrr UTSW 7 79694311 intron probably benign
PIT4305001:Ticrr UTSW 7 79679023 missense possibly damaging 0.95
PIT4791001:Ticrr UTSW 7 79669638 missense possibly damaging 0.92
R0016:Ticrr UTSW 7 79693792 missense probably benign 0.01
R0062:Ticrr UTSW 7 79667906 missense probably benign 0.01
R0062:Ticrr UTSW 7 79667906 missense probably benign 0.01
R0067:Ticrr UTSW 7 79677410 missense probably damaging 1.00
R0067:Ticrr UTSW 7 79677410 missense probably damaging 1.00
R0362:Ticrr UTSW 7 79677340 missense probably damaging 1.00
R0482:Ticrr UTSW 7 79694488 missense probably damaging 0.99
R0595:Ticrr UTSW 7 79695563 missense possibly damaging 0.94
R1118:Ticrr UTSW 7 79693953 missense probably benign 0.23
R1119:Ticrr UTSW 7 79693953 missense probably benign 0.23
R1572:Ticrr UTSW 7 79681824 missense probably damaging 1.00
R1658:Ticrr UTSW 7 79695549 missense possibly damaging 0.57
R1757:Ticrr UTSW 7 79675323 missense probably damaging 0.99
R1757:Ticrr UTSW 7 79679046 nonsense probably null
R1862:Ticrr UTSW 7 79695207 missense probably damaging 1.00
R1869:Ticrr UTSW 7 79679135 missense probably damaging 1.00
R1938:Ticrr UTSW 7 79675394 missense probably damaging 0.98
R1966:Ticrr UTSW 7 79694735 nonsense probably null
R2006:Ticrr UTSW 7 79694073 missense possibly damaging 0.93
R2178:Ticrr UTSW 7 79665685 missense probably benign 0.12
R3404:Ticrr UTSW 7 79694791 missense probably benign 0.06
R3405:Ticrr UTSW 7 79694791 missense probably benign 0.06
R3941:Ticrr UTSW 7 79693697 intron probably benign
R3950:Ticrr UTSW 7 79682069 missense probably damaging 1.00
R3951:Ticrr UTSW 7 79682069 missense probably damaging 1.00
R3952:Ticrr UTSW 7 79682069 missense probably damaging 1.00
R4967:Ticrr UTSW 7 79660410 missense probably damaging 0.99
R4972:Ticrr UTSW 7 79669668 missense probably damaging 0.98
R5259:Ticrr UTSW 7 79694723 missense probably benign 0.01
R5272:Ticrr UTSW 7 79669605 missense probably benign 0.44
R5374:Ticrr UTSW 7 79690942 nonsense probably null
R5480:Ticrr UTSW 7 79660809 missense probably damaging 1.00
R5568:Ticrr UTSW 7 79689967 critical splice donor site probably null
R5568:Ticrr UTSW 7 79695296 nonsense probably null
R5588:Ticrr UTSW 7 79679105 missense probably damaging 1.00
R5698:Ticrr UTSW 7 79679133 missense probably benign
R5879:Ticrr UTSW 7 79696690 missense probably benign 0.12
R5980:Ticrr UTSW 7 79660955 missense probably damaging 0.99
R6128:Ticrr UTSW 7 79693968 missense probably damaging 1.00
R6277:Ticrr UTSW 7 79694696 missense probably benign 0.00
R6335:Ticrr UTSW 7 79694283 unclassified probably null
R6866:Ticrr UTSW 7 79693957 missense possibly damaging 0.47
R6905:Ticrr UTSW 7 79665850 missense probably benign 0.00
R6962:Ticrr UTSW 7 79665897 missense possibly damaging 0.84
Predicted Primers PCR Primer
(F):5'- AAATCAGTTACTTCAGTTGCTCCC -3'
(R):5'- ATGTTCCCCAAGACTGCACC -3'

Sequencing Primer
(F):5'- AGAGGTCCTGAGTTCAATTCCCAG -3'
(R):5'- TTCCCCAAGACTGCACCATTTTAAAC -3'
Posted On2018-11-06