Incidental Mutation 'R6923:Me3'
ID539733
Institutional Source Beutler Lab
Gene Symbol Me3
Ensembl Gene ENSMUSG00000030621
Gene Namemalic enzyme 3, NADP(+)-dependent, mitochondrial
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.352) question?
Stock #R6923 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location89632392-89854359 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 89845885 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 337 (A337E)
Ref Sequence ENSEMBL: ENSMUSP00000032856 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032856]
Predicted Effect probably damaging
Transcript: ENSMUST00000032856
AA Change: A337E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032856
Gene: ENSMUSG00000030621
AA Change: A337E

DomainStartEndE-ValueType
malic 114 295 4.77e-105 SMART
Malic_M 305 557 5.68e-115 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.4%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Malic enzyme catalyzes the oxidative decarboxylation of malate to pyruvate using either NAD+ or NADP+ as a cofactor. Mammalian tissues contain 3 distinct isoforms of malic enzyme: a cytosolic NADP(+)-dependent isoform, a mitochondrial NADP(+)-dependent isoform, and a mitochondrial NAD(+)-dependent isoform. This gene encodes a mitochondrial NADP(+)-dependent isoform. Multiple alternatively spliced transcript variants have been found for this gene, but the biological validity of some variants has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T A 11: 78,274,626 S1323T possibly damaging Het
4930444G20Rik C A 10: 22,067,755 G109C probably damaging Het
5830473C10Rik A G 5: 90,577,793 N288S probably benign Het
Ap4b1 T A 3: 103,812,214 D81E probably benign Het
Atg16l1 A T 1: 87,774,356 probably null Het
Atp11a A G 8: 12,856,949 T459A probably damaging Het
AU019823 T A 9: 50,610,310 I104L probably benign Het
BC049762 C T 11: 51,253,981 D158N probably damaging Het
BC055324 A G 1: 163,986,885 probably null Het
Bloc1s5 T A 13: 38,631,064 I40F probably damaging Het
Capn5 T A 7: 98,129,254 Q386L probably damaging Het
Cbfa2t2 C T 2: 154,534,983 H529Y probably damaging Het
Cd3d T C 9: 44,985,859 probably benign Het
Cenpa A G 5: 30,672,462 probably null Het
Chit1 A T 1: 134,149,425 Y322F probably null Het
Cntnap5c T A 17: 58,092,350 N399K possibly damaging Het
Dock8 A T 19: 25,095,606 T417S probably benign Het
Fkbp2 A G 19: 6,979,169 Het
Fsip1 G A 2: 118,249,913 R121C probably benign Het
Gbp2b T C 3: 142,600,559 I131T probably benign Het
Gm10093 A G 17: 78,492,914 T445A possibly damaging Het
Gm12695 T C 4: 96,769,816 N39D probably benign Het
Gm13089 A T 4: 143,699,106 I89N probably benign Het
Gm4922 T C 10: 18,783,868 R369G probably damaging Het
Gpatch3 C T 4: 133,582,525 L390F probably damaging Het
Gpd2 G A 2: 57,355,788 M443I probably damaging Het
Gpt2 G A 8: 85,518,052 E325K probably benign Het
Jph3 A G 8: 121,753,371 T263A possibly damaging Het
Mndal A C 1: 173,884,698 probably null Het
Muc6 C T 7: 141,637,540 E2342K possibly damaging Het
Neb A G 2: 52,186,064 V5659A probably damaging Het
Nrxn1 G A 17: 91,088,233 A165V probably benign Het
Olfr1442 T A 19: 12,675,045 I280N possibly damaging Het
Olfr1447 T C 19: 12,901,312 N156S probably benign Het
Orc2 A G 1: 58,500,375 L35S probably benign Het
Pax4 A G 6: 28,447,119 probably null Het
Pcdhb7 C T 18: 37,342,469 probably null Het
Pla2r1 C T 2: 60,514,966 E349K probably benign Het
Polr2a C T 11: 69,735,961 A1516T probably benign Het
Prpf38a G T 4: 108,570,204 D187E possibly damaging Het
Rdh16f1 T A 10: 127,788,868 probably null Het
S100z T A 13: 95,478,582 D25V probably damaging Het
Scamp2 T G 9: 57,581,612 F199V probably damaging Het
Senp2 T G 16: 22,011,576 probably benign Het
Sltm T A 9: 70,574,610 S365T probably damaging Het
Smg6 C G 11: 74,929,343 P147A possibly damaging Het
Spem2 T A 11: 69,817,777 R121W probably damaging Het
Sufu A G 19: 46,450,966 probably null Het
Syt2 T C 1: 134,746,763 V313A possibly damaging Het
Tet2 C T 3: 133,479,341 probably null Het
Tfeb T A 17: 47,786,983 I232N probably benign Het
Ticrr T G 7: 79,691,853 I1062M probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vrk2 G A 11: 26,489,893 A226V probably damaging Het
Wnk1 A T 6: 119,965,678 probably benign Het
Xpo4 G T 14: 57,603,711 T505K probably benign Het
Yy1 A T 12: 108,793,668 I86F probably benign Het
Zc3h15 A G 2: 83,657,056 D73G possibly damaging Het
Other mutations in Me3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01153:Me3 APN 7 89849636 missense probably damaging 0.99
IGL01965:Me3 APN 7 89851743 missense probably benign 0.03
IGL02657:Me3 APN 7 89846253 missense probably benign 0.01
R0035:Me3 UTSW 7 89851759 missense probably benign 0.01
R0144:Me3 UTSW 7 89739872 missense probably damaging 0.98
R0206:Me3 UTSW 7 89849660 missense probably benign
R0206:Me3 UTSW 7 89849660 missense probably benign
R0360:Me3 UTSW 7 89786414 splice site probably null
R1501:Me3 UTSW 7 89633065 missense probably benign 0.01
R1579:Me3 UTSW 7 89845842 missense possibly damaging 0.53
R1613:Me3 UTSW 7 89786420 splice site probably benign
R1741:Me3 UTSW 7 89851833 missense probably damaging 1.00
R1757:Me3 UTSW 7 89633022 missense probably benign
R2177:Me3 UTSW 7 89633070 missense probably benign 0.16
R2202:Me3 UTSW 7 89850381 missense probably damaging 0.98
R3841:Me3 UTSW 7 89786493 missense possibly damaging 0.73
R3928:Me3 UTSW 7 89833690 splice site probably benign
R4183:Me3 UTSW 7 89851830 missense probably benign 0.19
R4274:Me3 UTSW 7 89806726 missense probably damaging 0.98
R4476:Me3 UTSW 7 89739860 missense probably damaging 1.00
R4532:Me3 UTSW 7 89632900 start gained probably benign
R4560:Me3 UTSW 7 89849730 missense probably benign 0.32
R4947:Me3 UTSW 7 89633014 missense probably benign
R5511:Me3 UTSW 7 89806668 missense probably damaging 1.00
R5622:Me3 UTSW 7 89796663 missense probably damaging 1.00
R5878:Me3 UTSW 7 89848006 missense probably benign 0.01
R6139:Me3 UTSW 7 89632900 start gained probably benign
R6265:Me3 UTSW 7 89849743 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTTTCTCCGACAGGTCCTGG -3'
(R):5'- TAGCCCCACAACTCCTAGATGG -3'

Sequencing Primer
(F):5'- CTCCGACAGGTCCTGGATGTTG -3'
(R):5'- ACTCCTAGATGGCCCAGTTAAATTC -3'
Posted On2018-11-06