Incidental Mutation 'R6923:Atp11a'
ID539736
Institutional Source Beutler Lab
Gene Symbol Atp11a
Ensembl Gene ENSMUSG00000031441
Gene NameATPase, class VI, type 11A
SynonymsIh, 4930558F19Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6923 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location12757014-12868728 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 12856949 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 459 (T459A)
Ref Sequence ENSEMBL: ENSMUSP00000117091 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033818] [ENSMUST00000091237] [ENSMUST00000132974] [ENSMUST00000133338]
Predicted Effect probably damaging
Transcript: ENSMUST00000033818
AA Change: T1006A

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000033818
Gene: ENSMUSG00000031441
AA Change: T1006A

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 25 96 3.6e-26 PFAM
Pfam:E1-E2_ATPase 101 377 1.1e-12 PFAM
low complexity region 382 393 N/A INTRINSIC
Pfam:HAD 411 837 9.9e-21 PFAM
Pfam:Cation_ATPase 476 589 2.5e-11 PFAM
Pfam:PhoLip_ATPase_C 854 1106 2e-74 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000091237
AA Change: T1006A

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000088779
Gene: ENSMUSG00000031441
AA Change: T1006A

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 25 96 7.3e-26 PFAM
Pfam:E1-E2_ATPase 101 377 2.7e-12 PFAM
low complexity region 382 393 N/A INTRINSIC
Pfam:HAD 411 837 1.9e-20 PFAM
Pfam:Cation_ATPase 476 589 7.4e-11 PFAM
Pfam:PhoLip_ATPase_C 854 1106 4.5e-74 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131804
SMART Domains Protein: ENSMUSP00000121567
Gene: ENSMUSG00000031441

DomainStartEndE-ValueType
SCOP:d1eula_ 6 53 1e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000132974
AA Change: T459A

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000117091
Gene: ENSMUSG00000031441
AA Change: T459A

DomainStartEndE-ValueType
Pfam:Hydrolase_like2 1 42 2.6e-8 PFAM
Pfam:HAD 17 290 4.1e-14 PFAM
Pfam:Hydrolase 20 293 7.7e-13 PFAM
transmembrane domain 420 442 N/A INTRINSIC
transmembrane domain 454 476 N/A INTRINSIC
transmembrane domain 491 513 N/A INTRINSIC
transmembrane domain 520 542 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000133338
SMART Domains Protein: ENSMUSP00000120625
Gene: ENSMUSG00000031441

DomainStartEndE-ValueType
Pfam:E1-E2_ATPase 99 291 7.3e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143359
SMART Domains Protein: ENSMUSP00000114312
Gene: ENSMUSG00000031441

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_C 1 98 2e-18 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000121989
Gene: ENSMUSG00000031441
AA Change: T124A

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_C 1 157 1.7e-43 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.4%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an integral membrane ATPase. The encoded protein is probably phosphorylated in its intermediate state and likely drives the transport of ions such as calcium across membranes. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T A 11: 78,274,626 S1323T possibly damaging Het
4930444G20Rik C A 10: 22,067,755 G109C probably damaging Het
5830473C10Rik A G 5: 90,577,793 N288S probably benign Het
Ap4b1 T A 3: 103,812,214 D81E probably benign Het
Atg16l1 A T 1: 87,774,356 probably null Het
AU019823 T A 9: 50,610,310 I104L probably benign Het
BC049762 C T 11: 51,253,981 D158N probably damaging Het
BC055324 A G 1: 163,986,885 probably null Het
Bloc1s5 T A 13: 38,631,064 I40F probably damaging Het
Capn5 T A 7: 98,129,254 Q386L probably damaging Het
Cbfa2t2 C T 2: 154,534,983 H529Y probably damaging Het
Cd3d T C 9: 44,985,859 probably benign Het
Cenpa A G 5: 30,672,462 probably null Het
Chit1 A T 1: 134,149,425 Y322F probably null Het
Cntnap5c T A 17: 58,092,350 N399K possibly damaging Het
Dock8 A T 19: 25,095,606 T417S probably benign Het
Fkbp2 A G 19: 6,979,169 Het
Fsip1 G A 2: 118,249,913 R121C probably benign Het
Gbp2b T C 3: 142,600,559 I131T probably benign Het
Gm10093 A G 17: 78,492,914 T445A possibly damaging Het
Gm12695 T C 4: 96,769,816 N39D probably benign Het
Gm13089 A T 4: 143,699,106 I89N probably benign Het
Gm4922 T C 10: 18,783,868 R369G probably damaging Het
Gpatch3 C T 4: 133,582,525 L390F probably damaging Het
Gpd2 G A 2: 57,355,788 M443I probably damaging Het
Gpt2 G A 8: 85,518,052 E325K probably benign Het
Jph3 A G 8: 121,753,371 T263A possibly damaging Het
Me3 C A 7: 89,845,885 A337E probably damaging Het
Mndal A C 1: 173,884,698 probably null Het
Muc6 C T 7: 141,637,540 E2342K possibly damaging Het
Neb A G 2: 52,186,064 V5659A probably damaging Het
Nrxn1 G A 17: 91,088,233 A165V probably benign Het
Olfr1442 T A 19: 12,675,045 I280N possibly damaging Het
Olfr1447 T C 19: 12,901,312 N156S probably benign Het
Orc2 A G 1: 58,500,375 L35S probably benign Het
Pax4 A G 6: 28,447,119 probably null Het
Pcdhb7 C T 18: 37,342,469 probably null Het
Pla2r1 C T 2: 60,514,966 E349K probably benign Het
Polr2a C T 11: 69,735,961 A1516T probably benign Het
Prpf38a G T 4: 108,570,204 D187E possibly damaging Het
Rdh16f1 T A 10: 127,788,868 probably null Het
S100z T A 13: 95,478,582 D25V probably damaging Het
Scamp2 T G 9: 57,581,612 F199V probably damaging Het
Senp2 T G 16: 22,011,576 probably benign Het
Sltm T A 9: 70,574,610 S365T probably damaging Het
Smg6 C G 11: 74,929,343 P147A possibly damaging Het
Spem2 T A 11: 69,817,777 R121W probably damaging Het
Sufu A G 19: 46,450,966 probably null Het
Syt2 T C 1: 134,746,763 V313A possibly damaging Het
Tet2 C T 3: 133,479,341 probably null Het
Tfeb T A 17: 47,786,983 I232N probably benign Het
Ticrr T G 7: 79,691,853 I1062M probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vrk2 G A 11: 26,489,893 A226V probably damaging Het
Wnk1 A T 6: 119,965,678 probably benign Het
Xpo4 G T 14: 57,603,711 T505K probably benign Het
Yy1 A T 12: 108,793,668 I86F probably benign Het
Zc3h15 A G 2: 83,657,056 D73G possibly damaging Het
Other mutations in Atp11a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01160:Atp11a APN 8 12844609 missense probably damaging 1.00
IGL01397:Atp11a APN 8 12812321 missense probably damaging 1.00
IGL01712:Atp11a APN 8 12851138 missense probably benign 0.11
IGL02113:Atp11a APN 8 12865048 missense probably benign
IGL02449:Atp11a APN 8 12757358 splice site probably null
IGL02550:Atp11a APN 8 12816997 missense possibly damaging 0.72
IGL03099:Atp11a APN 8 12827462 missense possibly damaging 0.52
R0139:Atp11a UTSW 8 12846054 missense probably benign 0.00
R0265:Atp11a UTSW 8 12856930 splice site probably benign
R0294:Atp11a UTSW 8 12827524 missense probably benign 0.03
R0331:Atp11a UTSW 8 12816953 nonsense probably null
R0582:Atp11a UTSW 8 12831214 missense probably benign 0.10
R1033:Atp11a UTSW 8 12828555 missense probably damaging 1.00
R1213:Atp11a UTSW 8 12842859 missense probably benign 0.04
R1551:Atp11a UTSW 8 12812340 missense probably damaging 1.00
R1648:Atp11a UTSW 8 12847495 missense probably damaging 1.00
R1752:Atp11a UTSW 8 12813094 missense probably damaging 1.00
R1826:Atp11a UTSW 8 12846154 missense probably damaging 1.00
R1887:Atp11a UTSW 8 12812324 missense probably damaging 1.00
R2079:Atp11a UTSW 8 12857902 missense probably damaging 1.00
R2106:Atp11a UTSW 8 12835228 missense probably benign
R2319:Atp11a UTSW 8 12847505 missense probably damaging 1.00
R2966:Atp11a UTSW 8 12847853 unclassified probably null
R4021:Atp11a UTSW 8 12842938 missense probably benign 0.01
R4183:Atp11a UTSW 8 12816990 missense possibly damaging 0.94
R4640:Atp11a UTSW 8 12828434 splice site probably benign
R4705:Atp11a UTSW 8 12813118 missense probably damaging 1.00
R5354:Atp11a UTSW 8 12806753 missense probably damaging 1.00
R5777:Atp11a UTSW 8 12832522 missense probably damaging 0.99
R6152:Atp11a UTSW 8 12846100 missense probably damaging 0.97
R6171:Atp11a UTSW 8 12832663 missense probably damaging 1.00
R6197:Atp11a UTSW 8 12846099 missense probably benign 0.01
R6335:Atp11a UTSW 8 12859481 critical splice donor site probably null
R6526:Atp11a UTSW 8 12864999 missense probably benign
R6792:Atp11a UTSW 8 12861939 unclassified probably benign
R6959:Atp11a UTSW 8 12820467 missense probably damaging 1.00
R7297:Atp11a UTSW 8 12806774 critical splice donor site probably null
X0017:Atp11a UTSW 8 12826323 critical splice acceptor site probably null
X0022:Atp11a UTSW 8 12847794 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TACATCCTTGACCCAGGCTTG -3'
(R):5'- GAAGTTCACGTGCTAGGCAG -3'

Sequencing Primer
(F):5'- GCTTGGCCATCATGCTGC -3'
(R):5'- TTCACTCGCTGGGACCTG -3'
Posted On2018-11-06