Incidental Mutation 'R6924:Zfp804b'
ID539780
Institutional Source Beutler Lab
Gene Symbol Zfp804b
Ensembl Gene ENSMUSG00000092094
Gene Namezinc finger protein 804B
SynonymsLOC207618
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.140) question?
Stock #R6924 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location6769010-7344756 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 6769902 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 1018 (V1018I)
Ref Sequence ENSEMBL: ENSMUSP00000130571 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164784] [ENSMUST00000200317]
Predicted Effect probably benign
Transcript: ENSMUST00000164784
AA Change: V1018I

PolyPhen 2 Score 0.089 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000130571
Gene: ENSMUSG00000092094
AA Change: V1018I

DomainStartEndE-ValueType
ZnF_C2H2 20 44 4.81e0 SMART
low complexity region 922 934 N/A INTRINSIC
low complexity region 1119 1143 N/A INTRINSIC
low complexity region 1160 1171 N/A INTRINSIC
low complexity region 1179 1198 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200317
AA Change: V1054I

PolyPhen 2 Score 0.071 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000143568
Gene: ENSMUSG00000092094
AA Change: V1054I

DomainStartEndE-ValueType
ZnF_C2H2 56 80 2e-2 SMART
low complexity region 958 970 N/A INTRINSIC
low complexity region 1155 1179 N/A INTRINSIC
low complexity region 1196 1207 N/A INTRINSIC
low complexity region 1215 1234 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.8%
Validation Efficiency 98% (54/55)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700009N14Rik A C 4: 39,450,884 H30P probably damaging Het
Abhd6 A T 14: 8,049,850 H213L possibly damaging Het
Adam22 T A 5: 8,367,322 N40I possibly damaging Het
Ankrd42 A G 7: 92,582,016 probably benign Het
Arhgap40 C T 2: 158,527,146 R63C probably benign Het
Atf7ip T G 6: 136,559,757 probably null Het
Atg7 T C 6: 114,709,211 probably null Het
Car6 A C 4: 150,189,256 probably null Het
Carmil1 A T 13: 24,075,684 C302* probably null Het
Ccdc117 A T 11: 5,534,255 M195K probably benign Het
Cep95 T C 11: 106,811,197 M383T probably damaging Het
Col20a1 A G 2: 180,996,850 E419G probably damaging Het
Cyp2d9 C G 15: 82,455,212 R272G probably damaging Het
Dhx57 A T 17: 80,238,815 M1380K possibly damaging Het
Dnah14 A G 1: 181,627,952 S881G probably benign Het
Fam126a T C 5: 23,986,135 probably null Het
Fcgbp T A 7: 28,093,823 I1084N probably benign Het
Fgf17 A T 14: 70,641,541 C21* probably null Het
Gemin4 A G 11: 76,212,336 L533P probably damaging Het
Gkn3 T C 6: 87,388,802 R12G probably benign Het
Gpr161 G T 1: 165,321,619 R519L possibly damaging Het
Grin2a A G 16: 9,663,228 V535A possibly damaging Het
Gys1 G A 7: 45,443,635 probably null Het
Hfm1 C T 5: 106,850,410 probably null Het
Hmcn2 T A 2: 31,350,505 probably null Het
Hnrnpul2 T C 19: 8,831,509 Y738H unknown Het
Igsf23 A G 7: 19,941,759 S141P possibly damaging Het
Lamc3 A C 2: 31,938,069 M1423L probably benign Het
Lcmt2 T C 2: 121,140,003 T200A probably benign Het
Lgr4 T C 2: 110,012,439 V899A probably damaging Het
Macf1 T A 4: 123,527,352 R36S possibly damaging Het
Mrgprb8 A G 7: 48,389,123 K181E possibly damaging Het
Muc2 G A 7: 141,697,834 V786M possibly damaging Het
Nacc2 T C 2: 26,090,029 T132A probably damaging Het
Nsmce2 T A 15: 59,378,925 I15K probably damaging Het
Olfr726 A G 14: 50,083,850 I277T possibly damaging Het
Olfr9 T G 10: 128,990,091 Y60D probably damaging Het
Otoa A T 7: 121,131,501 probably null Het
Otogl A G 10: 107,808,641 I1248T probably damaging Het
Ppp1r17 T A 6: 56,026,022 D32E probably damaging Het
Relt A C 7: 100,847,261 V427G probably damaging Het
Ric1 T A 19: 29,569,388 V256D probably damaging Het
Samhd1 T C 2: 157,109,483 T445A probably benign Het
Sepsecs T C 5: 52,664,304 I189V probably benign Het
Shroom3 T A 5: 92,964,403 D1793E probably damaging Het
Sim1 C T 10: 50,908,539 T137I probably benign Het
Stk17b A T 1: 53,761,059 D253E possibly damaging Het
Stmnd1 T C 13: 46,299,493 V215A probably benign Het
Tcl1 A G 12: 105,218,756 L65P probably damaging Het
Tiam2 A C 17: 3,507,795 K1231N probably damaging Het
Tm9sf3 T C 19: 41,218,278 Y476C probably damaging Het
Trim63 T C 4: 134,321,261 S194P probably damaging Het
Ugt1a10 T A 1: 88,055,657 I59N probably damaging Het
Vmn2r65 A G 7: 84,963,990 F7S probably benign Het
Zfp775 T A 6: 48,619,655 H154Q probably damaging Het
Other mutations in Zfp804b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01085:Zfp804b APN 5 6770931 missense probably damaging 1.00
IGL01726:Zfp804b APN 5 7180707 intron probably benign
IGL02020:Zfp804b APN 5 6769118 missense probably damaging 1.00
IGL02567:Zfp804b APN 5 6769989 missense probably benign 0.02
IGL02679:Zfp804b APN 5 6771392 missense possibly damaging 0.50
IGL03245:Zfp804b APN 5 6772253 missense possibly damaging 0.92
IGL03352:Zfp804b APN 5 6770039 missense probably benign 0.45
Flush UTSW 5 6770217 missense probably benign 0.27
gozinta UTSW 5 6770153 missense possibly damaging 0.90
healthy UTSW 5 6770013 missense probably benign 0.04
Paluka UTSW 5 6770534 missense probably benign
PIT4142001:Zfp804b UTSW 5 6769422 missense probably damaging 0.99
R0025:Zfp804b UTSW 5 6771665 missense probably damaging 1.00
R0044:Zfp804b UTSW 5 6769655 missense probably damaging 1.00
R0137:Zfp804b UTSW 5 6770534 missense probably benign
R0330:Zfp804b UTSW 5 6771029 missense possibly damaging 0.83
R0330:Zfp804b UTSW 5 6771994 missense possibly damaging 0.63
R0522:Zfp804b UTSW 5 6772014 missense probably benign 0.05
R1463:Zfp804b UTSW 5 7179372 intron probably benign
R1497:Zfp804b UTSW 5 6771105 missense probably damaging 0.97
R1511:Zfp804b UTSW 5 6769771 missense possibly damaging 0.87
R1633:Zfp804b UTSW 5 7179513 intron probably benign
R1666:Zfp804b UTSW 5 6771323 missense possibly damaging 0.93
R1668:Zfp804b UTSW 5 6771323 missense possibly damaging 0.93
R1677:Zfp804b UTSW 5 7179533 intron probably benign
R1698:Zfp804b UTSW 5 6769509 missense probably damaging 1.00
R1716:Zfp804b UTSW 5 6769673 missense probably benign 0.00
R1730:Zfp804b UTSW 5 6771938 missense probably damaging 0.99
R1747:Zfp804b UTSW 5 6770217 missense probably benign 0.27
R1776:Zfp804b UTSW 5 6769806 missense probably damaging 1.00
R1783:Zfp804b UTSW 5 6771938 missense probably damaging 0.99
R1804:Zfp804b UTSW 5 6771756 missense possibly damaging 0.78
R1885:Zfp804b UTSW 5 6770376 missense probably damaging 0.97
R1887:Zfp804b UTSW 5 6770376 missense probably damaging 0.97
R1900:Zfp804b UTSW 5 6769283 missense probably damaging 0.99
R1929:Zfp804b UTSW 5 6769748 missense probably benign 0.05
R2141:Zfp804b UTSW 5 6772583 missense probably benign 0.11
R2181:Zfp804b UTSW 5 6771674 missense probably damaging 1.00
R2401:Zfp804b UTSW 5 6769445 missense probably damaging 1.00
R2408:Zfp804b UTSW 5 7179410 intron probably benign
R3237:Zfp804b UTSW 5 6769239 missense probably benign
R3429:Zfp804b UTSW 5 7180625 intron probably benign
R3785:Zfp804b UTSW 5 6770153 missense possibly damaging 0.90
R4459:Zfp804b UTSW 5 6771481 missense probably damaging 0.99
R4460:Zfp804b UTSW 5 6771481 missense probably damaging 0.99
R4608:Zfp804b UTSW 5 6772584 missense probably benign 0.04
R4762:Zfp804b UTSW 5 6772250 missense probably benign 0.00
R4871:Zfp804b UTSW 5 6876479 missense probably damaging 1.00
R4910:Zfp804b UTSW 5 6770540 missense possibly damaging 0.69
R4973:Zfp804b UTSW 5 6771198 missense probably damaging 0.99
R5199:Zfp804b UTSW 5 6770013 missense probably benign 0.04
R5219:Zfp804b UTSW 5 6770703 missense probably benign 0.01
R5411:Zfp804b UTSW 5 6770071 missense probably benign 0.00
R6001:Zfp804b UTSW 5 6769043 missense probably benign 0.00
R6041:Zfp804b UTSW 5 6771231 missense probably benign 0.08
R6151:Zfp804b UTSW 5 6769910 missense probably benign
R6252:Zfp804b UTSW 5 6769478 missense probably damaging 0.99
R6283:Zfp804b UTSW 5 6769908 missense probably benign 0.01
R6346:Zfp804b UTSW 5 6770534 missense probably benign
R6520:Zfp804b UTSW 5 6769283 missense probably damaging 0.99
R6714:Zfp804b UTSW 5 6769239 missense probably benign 0.00
R6966:Zfp804b UTSW 5 6771615 missense probably damaging 1.00
R7027:Zfp804b UTSW 5 6770372 missense probably benign
R7042:Zfp804b UTSW 5 6770042 missense probably benign 0.00
R7076:Zfp804b UTSW 5 6769751 missense probably benign 0.02
R7099:Zfp804b UTSW 5 6772161 missense probably benign 0.37
X0027:Zfp804b UTSW 5 6771257 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGCACAGCTCTGTCATAGTAAG -3'
(R):5'- TGTAGGAGAACGGTATTGCC -3'

Sequencing Primer
(F):5'- TGGAATCAGTTACGCCAG -3'
(R):5'- GGAGAACGGTATTGCCTTTTTCAAAG -3'
Posted On2018-11-06