Incidental Mutation 'R6924:Atg7'
ID539789
Institutional Source Beutler Lab
Gene Symbol Atg7
Ensembl Gene ENSMUSG00000030314
Gene Nameautophagy related 7
Synonyms1810013K23Rik, Apg7l
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6924 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location114643097-114860614 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 114709211 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000138600 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032457] [ENSMUST00000169310] [ENSMUST00000182428] [ENSMUST00000182793] [ENSMUST00000182902] [ENSMUST00000183165]
Predicted Effect probably null
Transcript: ENSMUST00000032457
SMART Domains Protein: ENSMUSP00000032457
Gene: ENSMUSG00000030314

DomainStartEndE-ValueType
Pfam:ThiF 350 506 1.6e-38 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000169310
SMART Domains Protein: ENSMUSP00000133215
Gene: ENSMUSG00000030314

DomainStartEndE-ValueType
Pfam:ATG7_N 9 319 1.5e-106 PFAM
Pfam:ThiF 329 643 7.9e-61 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000182428
SMART Domains Protein: ENSMUSP00000138779
Gene: ENSMUSG00000030314

DomainStartEndE-ValueType
Pfam:ThiF 350 506 1.1e-37 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000182793
SMART Domains Protein: ENSMUSP00000138137
Gene: ENSMUSG00000030314

DomainStartEndE-ValueType
Pfam:ThiF 350 506 1.6e-38 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000182902
SMART Domains Protein: ENSMUSP00000138651
Gene: ENSMUSG00000030314

DomainStartEndE-ValueType
Pfam:ThiF 350 506 1.6e-38 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000183165
SMART Domains Protein: ENSMUSP00000138600
Gene: ENSMUSG00000030314

DomainStartEndE-ValueType
Pfam:ThiF 311 467 9.7e-38 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.8%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: This gene encodes an E1-like activating enzyme that is essential for autophagy and cytoplasmic to vacuole transport. The encoded protein is also thought to modulate p53-dependent cell cycle pathways during prolonged metabolic stress. It has been associated with multiple functions, including axon membrane trafficking, axonal homeostasis, mitophagy, adipose differentiation, and hematopoietic stem cell maintenance. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mutation of this gene causes impairment of constitutive and starvation-induced autophagy resulting in defective protein degradation. Homozygous null mice die within 1 day of birth and have decreased body weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700009N14Rik A C 4: 39,450,884 H30P probably damaging Het
Abhd6 A T 14: 8,049,850 H213L possibly damaging Het
Adam22 T A 5: 8,367,322 N40I possibly damaging Het
Ankrd42 A G 7: 92,582,016 probably benign Het
Arhgap40 C T 2: 158,527,146 R63C probably benign Het
Atf7ip T G 6: 136,559,757 probably null Het
Car6 A C 4: 150,189,256 probably null Het
Carmil1 A T 13: 24,075,684 C302* probably null Het
Ccdc117 A T 11: 5,534,255 M195K probably benign Het
Cep95 T C 11: 106,811,197 M383T probably damaging Het
Col20a1 A G 2: 180,996,850 E419G probably damaging Het
Cyp2d9 C G 15: 82,455,212 R272G probably damaging Het
Dhx57 A T 17: 80,238,815 M1380K possibly damaging Het
Dnah14 A G 1: 181,627,952 S881G probably benign Het
Fam126a T C 5: 23,986,135 probably null Het
Fcgbp T A 7: 28,093,823 I1084N probably benign Het
Fgf17 A T 14: 70,641,541 C21* probably null Het
Gemin4 A G 11: 76,212,336 L533P probably damaging Het
Gkn3 T C 6: 87,388,802 R12G probably benign Het
Gpr161 G T 1: 165,321,619 R519L possibly damaging Het
Grin2a A G 16: 9,663,228 V535A possibly damaging Het
Gys1 G A 7: 45,443,635 probably null Het
Hfm1 C T 5: 106,850,410 probably null Het
Hmcn2 T A 2: 31,350,505 probably null Het
Hnrnpul2 T C 19: 8,831,509 Y738H unknown Het
Igsf23 A G 7: 19,941,759 S141P possibly damaging Het
Lamc3 A C 2: 31,938,069 M1423L probably benign Het
Lcmt2 T C 2: 121,140,003 T200A probably benign Het
Lgr4 T C 2: 110,012,439 V899A probably damaging Het
Macf1 T A 4: 123,527,352 R36S possibly damaging Het
Mrgprb8 A G 7: 48,389,123 K181E possibly damaging Het
Muc2 G A 7: 141,697,834 V786M possibly damaging Het
Nacc2 T C 2: 26,090,029 T132A probably damaging Het
Nsmce2 T A 15: 59,378,925 I15K probably damaging Het
Olfr726 A G 14: 50,083,850 I277T possibly damaging Het
Olfr9 T G 10: 128,990,091 Y60D probably damaging Het
Otoa A T 7: 121,131,501 probably null Het
Otogl A G 10: 107,808,641 I1248T probably damaging Het
Ppp1r17 T A 6: 56,026,022 D32E probably damaging Het
Relt A C 7: 100,847,261 V427G probably damaging Het
Ric1 T A 19: 29,569,388 V256D probably damaging Het
Samhd1 T C 2: 157,109,483 T445A probably benign Het
Sepsecs T C 5: 52,664,304 I189V probably benign Het
Shroom3 T A 5: 92,964,403 D1793E probably damaging Het
Sim1 C T 10: 50,908,539 T137I probably benign Het
Stk17b A T 1: 53,761,059 D253E possibly damaging Het
Stmnd1 T C 13: 46,299,493 V215A probably benign Het
Tcl1 A G 12: 105,218,756 L65P probably damaging Het
Tiam2 A C 17: 3,507,795 K1231N probably damaging Het
Tm9sf3 T C 19: 41,218,278 Y476C probably damaging Het
Trim63 T C 4: 134,321,261 S194P probably damaging Het
Ugt1a10 T A 1: 88,055,657 I59N probably damaging Het
Vmn2r65 A G 7: 84,963,990 F7S probably benign Het
Zfp775 T A 6: 48,619,655 H154Q probably damaging Het
Zfp804b C T 5: 6,769,902 V1018I probably benign Het
Other mutations in Atg7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02969:Atg7 APN 6 114724923 missense possibly damaging 0.71
R1460:Atg7 UTSW 6 114703364 missense probably damaging 0.99
R1467:Atg7 UTSW 6 114858982 splice site probably benign
R1561:Atg7 UTSW 6 114701172 missense possibly damaging 0.52
R1755:Atg7 UTSW 6 114673677 missense possibly damaging 0.64
R1934:Atg7 UTSW 6 114701235 missense probably damaging 0.98
R1962:Atg7 UTSW 6 114706230 missense probably damaging 1.00
R1964:Atg7 UTSW 6 114706230 missense probably damaging 1.00
R2064:Atg7 UTSW 6 114703363 missense probably damaging 1.00
R3722:Atg7 UTSW 6 114695663 missense probably damaging 0.99
R3870:Atg7 UTSW 6 114697047 missense possibly damaging 0.71
R3926:Atg7 UTSW 6 114673678 missense possibly damaging 0.81
R4044:Atg7 UTSW 6 114701978 missense probably benign 0.00
R4111:Atg7 UTSW 6 114713294 missense probably damaging 0.98
R4212:Atg7 UTSW 6 114703425 missense probably benign 0.02
R4943:Atg7 UTSW 6 114697084 missense probably benign 0.25
R5216:Atg7 UTSW 6 114724949 missense probably damaging 0.96
R5465:Atg7 UTSW 6 114652532 missense probably benign
R5555:Atg7 UTSW 6 114702053 missense probably damaging 1.00
R5618:Atg7 UTSW 6 114673699 missense probably damaging 0.99
R5902:Atg7 UTSW 6 114673678 missense possibly damaging 0.81
R5903:Atg7 UTSW 6 114706293 nonsense probably null
R5980:Atg7 UTSW 6 114680236 missense possibly damaging 0.80
R6031:Atg7 UTSW 6 114671233 missense probably benign 0.01
R6031:Atg7 UTSW 6 114671233 missense probably benign 0.01
R6178:Atg7 UTSW 6 114724895 missense probably damaging 1.00
R6702:Atg7 UTSW 6 114671097 splice site probably null
R6941:Atg7 UTSW 6 114673678 missense possibly damaging 0.81
R7201:Atg7 UTSW 6 114777057 missense probably damaging 1.00
Z1088:Atg7 UTSW 6 114695686 missense probably benign 0.15
Predicted Primers PCR Primer
(F):5'- TCACCTAGGTCTGGCTGAAT -3'
(R):5'- GACCAAATGCCCCTATTAAAGTCT -3'

Sequencing Primer
(F):5'- CTAGGTCTGGCTGAATTAGAATATTC -3'
(R):5'- AGACAGTGGCCAGCCATT -3'
Posted On2018-11-06