Incidental Mutation 'R6924:Olfr726'
ID539809
Institutional Source Beutler Lab
Gene Symbol Olfr726
Ensembl Gene ENSMUSG00000060523
Gene Nameolfactory receptor 726
SynonymsMOR246-4, GA_x6K02T2PMLR-5775299-5774334
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R6924 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location50083570-50090953 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 50083850 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 277 (I277T)
Ref Sequence ENSEMBL: ENSMUSP00000149373 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072370] [ENSMUST00000206834] [ENSMUST00000213345] [ENSMUST00000215105] [ENSMUST00000215278] [ENSMUST00000217025] [ENSMUST00000217319] [ENSMUST00000217422]
Predicted Effect possibly damaging
Transcript: ENSMUST00000072370
AA Change: I277T

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000072207
Gene: ENSMUSG00000060523
AA Change: I277T

DomainStartEndE-ValueType
Pfam:7tm_4 31 304 1.3e-47 PFAM
Pfam:7TM_GPCR_Srsx 36 288 5.4e-8 PFAM
Pfam:7tm_1 41 287 7.5e-21 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000206834
AA Change: I277T

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000213345
AA Change: I277T

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000215105
AA Change: I277T

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000215278
AA Change: I277T

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000217025
AA Change: I277T

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000217319
AA Change: I277T

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000217422
AA Change: I277T

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.8%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700009N14Rik A C 4: 39,450,884 H30P probably damaging Het
Abhd6 A T 14: 8,049,850 H213L possibly damaging Het
Adam22 T A 5: 8,367,322 N40I possibly damaging Het
Ankrd42 A G 7: 92,582,016 probably benign Het
Arhgap40 C T 2: 158,527,146 R63C probably benign Het
Atf7ip T G 6: 136,559,757 probably null Het
Atg7 T C 6: 114,709,211 probably null Het
Car6 A C 4: 150,189,256 probably null Het
Carmil1 A T 13: 24,075,684 C302* probably null Het
Ccdc117 A T 11: 5,534,255 M195K probably benign Het
Cep95 T C 11: 106,811,197 M383T probably damaging Het
Col20a1 A G 2: 180,996,850 E419G probably damaging Het
Cyp2d9 C G 15: 82,455,212 R272G probably damaging Het
Dhx57 A T 17: 80,238,815 M1380K possibly damaging Het
Dnah14 A G 1: 181,627,952 S881G probably benign Het
Fam126a T C 5: 23,986,135 probably null Het
Fcgbp T A 7: 28,093,823 I1084N probably benign Het
Fgf17 A T 14: 70,641,541 C21* probably null Het
Gemin4 A G 11: 76,212,336 L533P probably damaging Het
Gkn3 T C 6: 87,388,802 R12G probably benign Het
Gpr161 G T 1: 165,321,619 R519L possibly damaging Het
Grin2a A G 16: 9,663,228 V535A possibly damaging Het
Gys1 G A 7: 45,443,635 probably null Het
Hfm1 C T 5: 106,850,410 probably null Het
Hmcn2 T A 2: 31,350,505 probably null Het
Hnrnpul2 T C 19: 8,831,509 Y738H unknown Het
Igsf23 A G 7: 19,941,759 S141P possibly damaging Het
Lamc3 A C 2: 31,938,069 M1423L probably benign Het
Lcmt2 T C 2: 121,140,003 T200A probably benign Het
Lgr4 T C 2: 110,012,439 V899A probably damaging Het
Macf1 T A 4: 123,527,352 R36S possibly damaging Het
Mrgprb8 A G 7: 48,389,123 K181E possibly damaging Het
Muc2 G A 7: 141,697,834 V786M possibly damaging Het
Nacc2 T C 2: 26,090,029 T132A probably damaging Het
Nsmce2 T A 15: 59,378,925 I15K probably damaging Het
Olfr9 T G 10: 128,990,091 Y60D probably damaging Het
Otoa A T 7: 121,131,501 probably null Het
Otogl A G 10: 107,808,641 I1248T probably damaging Het
Ppp1r17 T A 6: 56,026,022 D32E probably damaging Het
Relt A C 7: 100,847,261 V427G probably damaging Het
Ric1 T A 19: 29,569,388 V256D probably damaging Het
Samhd1 T C 2: 157,109,483 T445A probably benign Het
Sepsecs T C 5: 52,664,304 I189V probably benign Het
Shroom3 T A 5: 92,964,403 D1793E probably damaging Het
Sim1 C T 10: 50,908,539 T137I probably benign Het
Stk17b A T 1: 53,761,059 D253E possibly damaging Het
Stmnd1 T C 13: 46,299,493 V215A probably benign Het
Tcl1 A G 12: 105,218,756 L65P probably damaging Het
Tiam2 A C 17: 3,507,795 K1231N probably damaging Het
Tm9sf3 T C 19: 41,218,278 Y476C probably damaging Het
Trim63 T C 4: 134,321,261 S194P probably damaging Het
Ugt1a10 T A 1: 88,055,657 I59N probably damaging Het
Vmn2r65 A G 7: 84,963,990 F7S probably benign Het
Zfp775 T A 6: 48,619,655 H154Q probably damaging Het
Zfp804b C T 5: 6,769,902 V1018I probably benign Het
Other mutations in Olfr726
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01329:Olfr726 APN 14 50083997 missense probably benign 0.00
IGL01432:Olfr726 APN 14 50083947 missense probably benign 0.07
IGL01788:Olfr726 APN 14 50084502 missense probably damaging 1.00
IGL01957:Olfr726 APN 14 50084280 missense probably benign 0.00
IGL02132:Olfr726 APN 14 50084486 missense probably damaging 1.00
R0611:Olfr726 UTSW 14 50083853 missense probably damaging 1.00
R0689:Olfr726 UTSW 14 50084232 missense probably benign 0.01
R1556:Olfr726 UTSW 14 50084459 missense possibly damaging 0.90
R1710:Olfr726 UTSW 14 50084370 missense probably benign 0.01
R1791:Olfr726 UTSW 14 50084042 missense probably benign 0.03
R1804:Olfr726 UTSW 14 50083902 missense probably damaging 0.99
R1853:Olfr726 UTSW 14 50084120 missense probably damaging 1.00
R2034:Olfr726 UTSW 14 50083983 missense probably benign 0.34
R3155:Olfr726 UTSW 14 50084525 missense probably benign 0.09
R3156:Olfr726 UTSW 14 50084525 missense probably benign 0.09
R3939:Olfr726 UTSW 14 50083716 makesense probably null
R4392:Olfr726 UTSW 14 50084603 missense probably benign 0.24
R4533:Olfr726 UTSW 14 50083699 unclassified probably null
R4694:Olfr726 UTSW 14 50084019 missense probably benign
R5183:Olfr726 UTSW 14 50084546 missense probably damaging 0.99
R5859:Olfr726 UTSW 14 50084027 missense probably damaging 1.00
R6186:Olfr726 UTSW 14 50084525 missense probably damaging 0.98
R6357:Olfr726 UTSW 14 50083989 missense probably damaging 0.99
R6771:Olfr726 UTSW 14 50083989 missense probably damaging 0.99
R6834:Olfr726 UTSW 14 50084228 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCATTTTGGAAGTAGGTTAGACGG -3'
(R):5'- AGTGGAGTTCTCACCCTGAGTAC -3'

Sequencing Primer
(F):5'- AACTTGTCCAGGCTTCAG -3'
(R):5'- GGAGTTCTCACCCTGAGTACATTTG -3'
Posted On2018-11-06