Incidental Mutation 'R6928:Gm4778'
ID539830
Institutional Source Beutler Lab
Gene Symbol Gm4778
Ensembl Gene ENSMUSG00000089696
Gene Namepredicted gene 4778
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.920) question?
Stock #R6928 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location94264036-94266784 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 94266548 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 288 (C288S)
Ref Sequence ENSEMBL: ENSMUSP00000096477 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098878] [ENSMUST00000159517]
Predicted Effect probably benign
Transcript: ENSMUST00000098878
AA Change: C288S

PolyPhen 2 Score 0.310 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000096477
Gene: ENSMUSG00000089696
AA Change: C288S

DomainStartEndE-ValueType
MATH 25 134 6.01e-8 SMART
BTB 192 291 7.66e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159517
AA Change: C284S

PolyPhen 2 Score 0.062 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000123868
Gene: ENSMUSG00000089696
AA Change: C284S

DomainStartEndE-ValueType
MATH 21 130 6.01e-8 SMART
BTB 188 287 7.66e-26 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 97.5%
Validation Efficiency 98% (62/63)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcyap1r1 A G 6: 55,479,272 D215G possibly damaging Het
Asb3 A T 11: 30,998,326 M40L probably damaging Het
Aspg G A 12: 112,126,689 V547M possibly damaging Het
Aspm T A 1: 139,480,206 L2277* probably null Het
Atp7b A G 8: 21,994,812 S1295P probably benign Het
Cdca2 A G 14: 67,705,744 S199P probably damaging Het
Cdh1 A G 8: 106,661,010 E514G possibly damaging Het
Cenpk G T 13: 104,228,992 probably benign Het
Col6a5 C A 9: 105,939,919 V398L unknown Het
Colec10 A T 15: 54,462,606 K277N probably damaging Het
Cryzl2 T G 1: 157,470,787 S249A probably benign Het
Cspg4 T A 9: 56,897,880 Y1992N possibly damaging Het
Drd3 G T 16: 43,821,320 R333L probably benign Het
Espl1 C T 15: 102,298,907 R269C probably benign Het
Esr2 C T 12: 76,165,478 C188Y probably damaging Het
Focad A G 4: 88,348,875 D1041G unknown Het
Frem3 T C 8: 80,611,282 F68S possibly damaging Het
Gapdh A G 6: 125,162,671 V212A probably damaging Het
Gm10471 A G 5: 26,085,588 probably null Het
Gm3854 T C 7: 6,354,267 Y360H probably damaging Het
Gm4858 G A 3: 93,073,960 C95Y probably damaging Het
Gzmb T C 14: 56,260,277 K169E probably benign Het
Hexdc T A 11: 121,212,054 F33I possibly damaging Het
Hsd3b6 T C 3: 98,810,953 I32V probably benign Het
Jcad T C 18: 4,673,372 V378A probably benign Het
Kcnmb2 T C 3: 32,199,041 S177P probably benign Het
Lrriq1 A T 10: 103,214,939 S651T possibly damaging Het
Map3k2 T C 18: 32,207,540 probably null Het
Mib1 T G 18: 10,802,282 S870A probably benign Het
Moap1 T A 12: 102,742,612 N226I probably damaging Het
Moxd1 T A 10: 24,300,288 N547K probably damaging Het
Mtmr9 A G 14: 63,543,593 V16A probably benign Het
Nme1 T C 11: 93,959,403 Y151C probably damaging Het
Nwd1 T C 8: 72,682,025 F879L probably benign Het
Nynrin T G 14: 55,863,878 S335A probably benign Het
Olfr1451 A G 19: 12,999,838 N284S probably damaging Het
Olfr1454 A T 19: 13,063,984 H191L probably benign Het
Olfr209 C A 16: 59,361,463 G252C probably damaging Het
Olfr655 A T 7: 104,596,589 Y197* probably null Het
Olfr930 T C 9: 38,930,566 Y132H probably damaging Het
Olfr935 T C 9: 38,994,632 M268V probably benign Het
Pcdhb21 A G 18: 37,514,421 E201G probably damaging Het
Plscr1 T C 9: 92,269,951 V301A possibly damaging Het
Psg28 A T 7: 18,423,078 S411T possibly damaging Het
Rif1 T C 2: 52,095,961 W653R probably damaging Het
Rnd3 T A 2: 51,132,506 I175L probably benign Het
Rtn4 A G 11: 29,706,791 E199G possibly damaging Het
Sgpp1 T C 12: 75,716,570 Y279C probably damaging Het
Slc2a13 A G 15: 91,276,179 I524T probably damaging Het
Spg11 C T 2: 122,069,904 V1556I probably benign Het
Srebf2 C T 15: 82,203,723 R215* probably null Het
Tmem19 T C 10: 115,347,274 N147S possibly damaging Het
Tpr T C 1: 150,408,785 S408P possibly damaging Het
Trav13d-4 C T 14: 53,073,161 T53I probably damaging Het
Trf T A 9: 103,222,108 R168W possibly damaging Het
Trim11 A G 11: 58,988,843 K273R probably damaging Het
Tsacc T A 3: 88,282,940 M68L probably benign Het
Ttn T A 2: 76,754,525 M22110L probably benign Het
Zfp160 G T 17: 21,041,462 G104V probably benign Het
Zranb1 G A 7: 132,966,594 R301H possibly damaging Het
Other mutations in Gm4778
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01767:Gm4778 APN 3 94266484 missense probably benign 0.00
IGL02032:Gm4778 APN 3 94266333 missense probably damaging 1.00
IGL02694:Gm4778 APN 3 94266152 missense probably benign
IGL03171:Gm4778 APN 3 94266455 missense probably benign 0.00
R0195:Gm4778 UTSW 3 94265922 missense possibly damaging 0.79
R0739:Gm4778 UTSW 3 94265795 missense probably benign 0.17
R1064:Gm4778 UTSW 3 94265795 missense probably benign 0.17
R1149:Gm4778 UTSW 3 94265795 missense probably benign 0.17
R1149:Gm4778 UTSW 3 94265795 missense probably benign 0.17
R1150:Gm4778 UTSW 3 94265795 missense probably benign 0.17
R1152:Gm4778 UTSW 3 94265795 missense probably benign 0.17
R1284:Gm4778 UTSW 3 94265795 missense probably benign 0.17
R1286:Gm4778 UTSW 3 94265795 missense probably benign 0.17
R1287:Gm4778 UTSW 3 94265795 missense probably benign 0.17
R1349:Gm4778 UTSW 3 94266128 missense possibly damaging 0.94
R1358:Gm4778 UTSW 3 94265795 missense probably benign 0.17
R1372:Gm4778 UTSW 3 94266128 missense possibly damaging 0.94
R1383:Gm4778 UTSW 3 94265795 missense probably benign 0.17
R1399:Gm4778 UTSW 3 94265795 missense probably benign 0.17
R1756:Gm4778 UTSW 3 94266218 missense probably benign
R1996:Gm4778 UTSW 3 94265711 missense probably benign 0.00
R2679:Gm4778 UTSW 3 94265910 missense probably damaging 1.00
R2878:Gm4778 UTSW 3 94266480 missense possibly damaging 0.69
R5108:Gm4778 UTSW 3 94265835 missense probably damaging 1.00
R5706:Gm4778 UTSW 3 94266652 missense possibly damaging 0.91
R6251:Gm4778 UTSW 3 94265901 missense probably damaging 1.00
R7091:Gm4778 UTSW 3 94266638 missense probably damaging 1.00
R7264:Gm4778 UTSW 3 94265738 missense possibly damaging 0.86
R7503:Gm4778 UTSW 3 94266473 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- TCTCCAGTTTTCAGAGCCATG -3'
(R):5'- GAATGTTTCAGCCACCAAGTG -3'

Sequencing Primer
(F):5'- CCAGTTTTCAGAGCCATGTTTGAAC -3'
(R):5'- CACCAAGTGGGGATGGGACTC -3'
Posted On2018-11-06