Incidental Mutation 'R6930:Zic2'
ID539975
Institutional Source Beutler Lab
Gene Symbol Zic2
Ensembl Gene ENSMUSG00000061524
Gene Namezinc finger protein of the cerebellum 2
Synonymsodd-paired homolog, GENA 29, Ku
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.823) question?
Stock #R6930 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location122475435-122479852 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 122476457 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 261 (D261V)
Ref Sequence ENSEMBL: ENSMUSP00000075283 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075888]
Predicted Effect probably damaging
Transcript: ENSMUST00000075888
AA Change: D261V

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000075283
Gene: ENSMUSG00000061524
AA Change: D261V

DomainStartEndE-ValueType
low complexity region 18 33 N/A INTRINSIC
low complexity region 81 103 N/A INTRINSIC
low complexity region 131 150 N/A INTRINSIC
low complexity region 215 241 N/A INTRINSIC
ZnF_C2H2 265 290 5.68e1 SMART
ZnF_C2H2 299 326 6.92e0 SMART
ZnF_C2H2 332 356 8.02e-5 SMART
ZnF_C2H2 362 386 1.69e-3 SMART
ZnF_C2H2 392 414 4.54e-4 SMART
low complexity region 416 434 N/A INTRINSIC
low complexity region 455 519 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 99.0%
  • 20x: 96.5%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ZIC family of C2H2-type zinc finger proteins. This protein functions as a transcriptional repressor and may regulate tissue specific expression of dopamine receptor D1. Expansion of an alanine repeat in the C-terminus of the encoded protein and other mutations in this gene cause holoprosencephaly type 5. Holoprosencephaly is the most common structural anomaly of the human brain. A polyhistidine tract polymorphism in this gene may be associated with increased risk of neural tube defects. This gene is closely linked to a gene encoding zinc finger protein of the cerebellum 5, a related family member on chromosome 13. [provided by RefSeq, Jul 2016]
PHENOTYPE: Defects in neurulation and forebrain development have been identified in both targeted and ENU induced homozygous mutants. Death occurs perinatally in the targeted mouse and during midgestation in the ENU mouse. Mice homozygous for a knock-down allele exhibit cognitive and social behavior defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700093K21Rik A T 11: 23,516,563 D156E probably benign Het
2010300C02Rik A T 1: 37,624,945 I624N possibly damaging Het
Adam17 A T 12: 21,353,948 V99E probably damaging Het
Akr1e1 T C 13: 4,602,715 D41G probably damaging Het
Alcam T C 16: 52,305,655 I100V probably benign Het
Atr T C 9: 95,866,635 I411T probably benign Het
Bbs4 T C 9: 59,323,481 S453G probably benign Het
Brdt C T 5: 107,359,215 L494F probably benign Het
Ccser1 T C 6: 62,380,025 S816P probably benign Het
Cdk10 T C 8: 123,230,608 I157T probably damaging Het
Ceacam5 G A 7: 17,750,834 probably null Het
Chst15 T C 7: 132,269,030 I259V possibly damaging Het
Csmd1 A T 8: 16,092,395 M1498K probably damaging Het
D630045J12Rik T C 6: 38,158,216 D1343G probably damaging Het
Denr T C 5: 123,908,187 Y27H probably benign Het
Dopey1 T C 9: 86,531,772 probably null Het
Epg5 T C 18: 78,014,163 F1819S probably damaging Het
Flg2 T A 3: 93,201,335 Y223* probably null Het
Fry T C 5: 150,428,230 L1733P probably benign Het
Gabrb2 T C 11: 42,597,613 V302A probably damaging Het
Gimap9 G A 6: 48,677,667 D53N probably damaging Het
Gje1 G T 10: 14,718,142 L3I possibly damaging Het
Gm49383 G T 12: 69,192,812 A645E probably damaging Het
Gm8947 G A 1: 151,192,596 G60D probably damaging Het
Gpatch2l G A 12: 86,244,184 R47H probably damaging Het
Gys2 A G 6: 142,459,380 probably null Het
Hace1 A G 10: 45,618,502 H136R probably damaging Het
Herc3 T G 6: 58,916,459 V902G probably damaging Het
Hspbp1 T C 7: 4,684,607 R2G probably benign Het
Iqch T A 9: 63,480,574 K811N possibly damaging Het
Kmt2a A G 9: 44,842,665 probably benign Het
Lonrf2 A T 1: 38,804,336 V372D probably benign Het
Lpin2 T C 17: 71,244,791 Y729H probably damaging Het
Lrrc32 A G 7: 98,499,264 N417S possibly damaging Het
Malrd1 T A 2: 15,797,667 C1064S unknown Het
Mast3 G A 8: 70,799,471 R20* probably null Het
Mypn A C 10: 63,116,939 I174S probably damaging Het
Nrg1 G A 8: 31,818,506 T505M probably damaging Het
Olfr1340 A G 4: 118,727,141 K298R probably damaging Het
Olfr18 A G 9: 20,314,099 Y266H probably damaging Het
Olfr220 A G 1: 174,449,111 I163V probably damaging Het
Olfr8 A G 10: 78,955,781 D192G possibly damaging Het
Phf3 T C 1: 30,811,877 E1132G probably damaging Het
Pla2g4d A T 2: 120,270,633 M521K probably damaging Het
Plekhg1 A G 10: 3,963,770 H1164R possibly damaging Het
Plxnb2 A G 15: 89,160,389 V1218A probably benign Het
Pold1 A G 7: 44,542,206 S119P probably benign Het
Pole T A 5: 110,293,290 D203E probably benign Het
Rapgefl1 T A 11: 98,847,121 L387Q probably damaging Het
Rbm33 T C 5: 28,352,506 I199T probably benign Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Rufy1 C A 11: 50,398,380 R545L probably benign Het
Ryr3 T A 2: 112,860,354 D1117V probably damaging Het
Sap130 T C 18: 31,682,088 V621A possibly damaging Het
Sparcl1 T A 5: 104,087,074 Y525F probably damaging Het
Spon2 A G 5: 33,216,427 V180A probably benign Het
Trav10n G A 14: 53,122,490 V75M probably benign Het
Ttc34 T C 4: 154,839,086 L84P probably damaging Het
Vmn1r23 C T 6: 57,926,145 R216K probably benign Het
Vmn2r61 A G 7: 42,299,940 T595A probably benign Het
Vmn2r66 T A 7: 85,012,008 I5F possibly damaging Het
Zfp879 C T 11: 50,833,012 G406R probably damaging Het
Other mutations in Zic2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00816:Zic2 APN 14 122478559 nonsense probably null
IGL01607:Zic2 APN 14 122478882 splice site probably benign
IGL02307:Zic2 APN 14 122476634 missense possibly damaging 0.76
IGL02311:Zic2 APN 14 122476194 missense probably damaging 0.99
IGL02561:Zic2 APN 14 122478545 nonsense probably null
IGL02982:Zic2 APN 14 122478567 missense probably damaging 0.98
R0001:Zic2 UTSW 14 122478957 missense probably damaging 0.99
R0027:Zic2 UTSW 14 122476343 missense possibly damaging 0.77
R0136:Zic2 UTSW 14 122476541 missense probably damaging 0.96
R0310:Zic2 UTSW 14 122476364 small deletion probably benign
R0418:Zic2 UTSW 14 122476364 small deletion probably benign
R0420:Zic2 UTSW 14 122476364 small deletion probably benign
R0421:Zic2 UTSW 14 122476364 small deletion probably benign
R0518:Zic2 UTSW 14 122476364 small deletion probably benign
R0520:Zic2 UTSW 14 122476364 small deletion probably benign
R0521:Zic2 UTSW 14 122476364 small deletion probably benign
R0628:Zic2 UTSW 14 122476364 small deletion probably benign
R1733:Zic2 UTSW 14 122478947 missense probably damaging 0.97
R1757:Zic2 UTSW 14 122478619 missense possibly damaging 0.86
R2398:Zic2 UTSW 14 122478917 nonsense probably null
R5323:Zic2 UTSW 14 122476316 missense probably damaging 1.00
R5381:Zic2 UTSW 14 122475815 missense probably damaging 0.97
Z1088:Zic2 UTSW 14 122478675 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GTGCTCAATGGGCAAATGC -3'
(R):5'- ACCAGTTTGTATTTGGCCTTAAAGG -3'

Sequencing Primer
(F):5'- CGGAGCAATACCGCCAAGTG -3'
(R):5'- TGGCCTTAAAGGGTTTGCC -3'
Posted On2018-11-06