Incidental Mutation 'R6931:Frem1'
ID540004
Institutional Source Beutler Lab
Gene Symbol Frem1
Ensembl Gene ENSMUSG00000059049
Gene NameFras1 related extracellular matrix protein 1
Synonymseyes2, heb, eye, crf11, QBRICK
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.702) question?
Stock #R6931 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location82897920-83052339 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 82970677 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 1085 (P1085S)
Ref Sequence ENSEMBL: ENSMUSP00000125809 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071708] [ENSMUST00000107230] [ENSMUST00000170248]
Predicted Effect probably damaging
Transcript: ENSMUST00000071708
AA Change: P1103S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000071627
Gene: ENSMUSG00000059049
AA Change: P1103S

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Pfam:Cadherin_3 364 508 1.7e-37 PFAM
Pfam:Cadherin_3 509 623 3.7e-18 PFAM
Pfam:Cadherin_3 592 709 8.4e-16 PFAM
Pfam:Cadherin_3 746 894 4.8e-26 PFAM
Pfam:Cadherin_3 863 1009 2.8e-30 PFAM
Pfam:Cadherin_3 1024 1115 6.4e-13 PFAM
Pfam:Cadherin_3 1119 1252 1.4e-17 PFAM
Pfam:Cadherin_3 1243 1393 8.2e-35 PFAM
Pfam:Cadherin_3 1378 1506 2e-22 PFAM
Pfam:Cadherin_3 1506 1616 1e-29 PFAM
Pfam:Cadherin_3 1617 1744 1.5e-14 PFAM
Pfam:Calx-beta 1749 1848 2.6e-10 PFAM
low complexity region 1894 1910 N/A INTRINSIC
CLECT 2065 2188 2.25e-27 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107230
AA Change: P1084S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102849
Gene: ENSMUSG00000059049
AA Change: P1084S

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
internal_repeat_1 296 967 9.01e-39 PROSPERO
internal_repeat_1 1026 1705 9.01e-39 PROSPERO
Pfam:Calx-beta 1730 1829 6.7e-10 PFAM
low complexity region 1875 1891 N/A INTRINSIC
CLECT 2046 2169 2.25e-27 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000122467
Gene: ENSMUSG00000059049
AA Change: P9S

DomainStartEndE-ValueType
Pfam:Cadherin_3 26 158 1.1e-18 PFAM
Pfam:Cadherin_3 150 300 4.6e-36 PFAM
Pfam:Cadherin_3 285 408 6e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000170248
AA Change: P1085S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125809
Gene: ENSMUSG00000059049
AA Change: P1085S

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Pfam:Cadherin_3 365 509 1.3e-37 PFAM
Pfam:Cadherin_3 510 623 4.5e-18 PFAM
Pfam:Cadherin_3 593 711 6.1e-16 PFAM
Pfam:Cadherin_3 728 876 2.7e-27 PFAM
Pfam:Cadherin_3 845 991 2.1e-30 PFAM
Pfam:Cadherin_3 1006 1097 4.8e-13 PFAM
Pfam:Cadherin_3 1101 1234 1e-17 PFAM
Pfam:Cadherin_3 1225 1375 6.1e-35 PFAM
Pfam:Cadherin_3 1360 1488 1.5e-22 PFAM
Pfam:Cadherin_3 1488 1598 7.5e-30 PFAM
Pfam:Cadherin_3 1599 1726 1.1e-14 PFAM
Pfam:Calx-beta 1731 1830 6.4e-10 PFAM
low complexity region 1876 1892 N/A INTRINSIC
CLECT 2047 2170 2.25e-27 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a basement membrane protein that may play a role in craniofacial and renal development. Mutations in this gene have been associated with bifid nose with or without anorectal and renal anomalies. Alternatively spliced transcript variants encoding different isoforms have been described. PubMed ID 19940113 describes one such variant that initiates transcription within a distinct, internal exon; the resulting shorter isoform (named Toll-like/interleukin-1 receptor regulator, TILRR) is suggested to be a co-receptor of the interleukin 1 receptor family and may regulate receptor function and Toll-like receptor/interleukin 1 receptor signal transduction, contributing to the control of inflammatory response activation. [provided by RefSeq, Apr 2011]
PHENOTYPE: Homozygous mutation of this gene results in subepidermal blistering, cryptophthalmos, syndactyly, and renal agenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik T C 6: 96,165,548 T172A possibly damaging Het
2310003L06Rik T A 5: 87,970,702 I15N probably damaging Het
2900092C05Rik T A 7: 12,512,596 S6R unknown Het
Abca6 T A 11: 110,244,328 L210F probably benign Het
Abcc4 T C 14: 118,527,988 Q919R probably damaging Het
Adcy1 A G 11: 7,150,884 D811G possibly damaging Het
Akna A G 4: 63,387,102 S476P probably benign Het
Ankrd49 T C 9: 14,782,826 N15S probably benign Het
Apcdd1 A G 18: 62,933,908 D31G probably damaging Het
Aplp1 G T 7: 30,443,200 R106S probably damaging Het
Arhgap40 T C 2: 158,531,218 L132S probably benign Het
Atp8b5 G T 4: 43,364,108 probably null Het
Axl T C 7: 25,761,433 D717G probably damaging Het
Bub1 T A 2: 127,801,382 D1014V probably damaging Het
Cacna2d4 T A 6: 119,282,234 V603E possibly damaging Het
Cnot11 G C 1: 39,539,921 C289S probably damaging Het
Coasy A G 11: 101,083,581 H191R probably benign Het
Cyp11a1 A T 9: 58,025,120 N341Y possibly damaging Het
Cyp1a2 T C 9: 57,682,156 N125S probably benign Het
Cyp2j8 A T 4: 96,444,781 probably null Het
Dnah9 A T 11: 66,117,626 I791K possibly damaging Het
Ecm2 A T 13: 49,529,011 Q505H probably benign Het
Fam135a T A 1: 24,085,487 M1L probably damaging Het
Fam171a2 A G 11: 102,438,434 S500P possibly damaging Het
Fat3 A G 9: 15,959,942 S3718P possibly damaging Het
Gcfc2 A G 6: 81,942,985 I390V probably benign Het
Gemin4 A G 11: 76,210,956 L993P probably damaging Het
Ggnbp2 T A 11: 84,833,167 D647V probably damaging Het
Gm7534 A T 4: 134,193,153 M567K probably benign Het
Gpr84 A C 15: 103,309,014 L212R probably damaging Het
Hnrnpu T C 1: 178,331,432 probably benign Het
Hspg2 G T 4: 137,540,720 C2116F probably damaging Het
Icam4 T A 9: 21,030,451 V249E probably damaging Het
Itga1 T C 13: 115,001,563 N429D probably benign Het
Kcns1 T C 2: 164,164,838 T402A probably damaging Het
Ky T A 9: 102,537,627 V246E probably damaging Het
March1 A G 8: 66,468,492 T529A probably benign Het
Med18 C G 4: 132,459,883 V102L probably damaging Het
Mlst8 T C 17: 24,477,275 D160G probably damaging Het
Mthfd1 T C 12: 76,303,698 I470T probably benign Het
Muc1 C T 3: 89,229,159 probably benign Het
Mup8 G A 4: 60,220,322 L137F probably damaging Het
Mybpc1 A T 10: 88,542,330 L341* probably null Het
Nacad A G 11: 6,601,877 F438S probably benign Het
Necap2 C A 4: 141,078,212 probably null Het
Nifk T C 1: 118,332,348 L163S possibly damaging Het
Npsr1 A G 9: 24,289,997 I73V probably benign Het
Olfr1179 G A 2: 88,402,064 T290I probably benign Het
Olfr1186 T A 2: 88,526,194 C204S possibly damaging Het
Olfr142 A T 2: 90,252,777 C70* probably null Het
Olfr715 A G 7: 107,128,901 L164P probably damaging Het
Oog3 C T 4: 144,159,353 C225Y probably benign Het
Plagl2 C A 2: 153,235,943 K39N probably benign Het
Plcg2 T A 8: 117,557,319 D118E probably benign Het
Ppp4r3b A T 11: 29,211,786 K720I possibly damaging Het
Prmt3 A T 7: 49,829,016 T442S probably benign Het
Prr14l G A 5: 32,830,691 H487Y probably damaging Het
Psmb3 G A 11: 97,703,971 V63I probably benign Het
Psmc6 T A 14: 45,343,725 I326K possibly damaging Het
Ptcd1 T C 5: 145,155,075 T405A probably benign Het
Rbm33 G A 5: 28,410,745 V29M probably damaging Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Scarb1 T A 5: 125,284,719 I107F probably damaging Het
Slc39a12 A G 2: 14,389,375 S19G probably benign Het
Slc44a5 T C 3: 154,258,506 V503A probably benign Het
Slc9a9 T C 9: 94,670,086 S9P possibly damaging Het
Snrnp35 A C 5: 124,490,701 R192S possibly damaging Het
Tbx15 T C 3: 99,352,151 L446P probably damaging Het
Tlnrd1 A G 7: 83,882,597 F209L probably benign Het
Tmprss12 C T 15: 100,285,268 R164C probably damaging Het
Tnfsf4 T A 1: 161,417,073 F111Y possibly damaging Het
Trib2 A T 12: 15,793,639 M198K probably benign Het
Ttll8 A G 15: 88,914,304 S743P possibly damaging Het
Ush2a A T 1: 188,728,383 N2614Y probably benign Het
Usp6nl G A 2: 6,430,458 V343I possibly damaging Het
Vrtn C A 12: 84,650,242 Q589K probably benign Het
Zbed5 T A 5: 129,903,329 Y706* probably null Het
Zc3h10 A G 10: 128,544,684 V268A probably damaging Het
Zfp442 C T 2: 150,410,940 probably null Het
Other mutations in Frem1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Frem1 APN 4 82959389 missense possibly damaging 0.46
IGL01069:Frem1 APN 4 83013867 missense probably benign 0.00
IGL01106:Frem1 APN 4 82922257 missense probably benign 0.00
IGL01398:Frem1 APN 4 82950362 missense possibly damaging 0.64
IGL01617:Frem1 APN 4 82936139 missense probably benign 0.02
IGL01647:Frem1 APN 4 82950356 missense possibly damaging 0.60
IGL01690:Frem1 APN 4 82959296 splice site probably benign
IGL02006:Frem1 APN 4 82992800 critical splice donor site probably null
IGL02069:Frem1 APN 4 82903551 missense probably damaging 1.00
IGL02131:Frem1 APN 4 82924854 missense probably benign 0.03
IGL02225:Frem1 APN 4 82940506 missense probably damaging 1.00
IGL02439:Frem1 APN 4 82956345 missense probably benign 0.00
IGL02567:Frem1 APN 4 83000055 missense probably damaging 1.00
IGL02647:Frem1 APN 4 83001754 missense probably damaging 1.00
IGL02653:Frem1 APN 4 82959334 missense probably benign 0.22
IGL02831:Frem1 APN 4 82956158 missense probably benign 0.31
IGL02997:Frem1 APN 4 82934968 missense probably damaging 1.00
IGL03005:Frem1 APN 4 82994134 missense probably damaging 1.00
IGL03036:Frem1 APN 4 82959339 missense possibly damaging 0.55
IGL03193:Frem1 APN 4 82994026 splice site probably benign
IGL03218:Frem1 APN 4 82914646 missense probably benign 0.00
IGL03235:Frem1 APN 4 83020755 missense possibly damaging 0.87
IGL03243:Frem1 APN 4 83013969 missense probably damaging 1.00
bat UTSW 4 82983060 intron probably benign
PIT4131001:Frem1 UTSW 4 83005808 missense probably damaging 0.99
PIT4466001:Frem1 UTSW 4 82972137 missense probably benign 0.01
PIT4472001:Frem1 UTSW 4 82972137 missense probably benign 0.01
PIT4515001:Frem1 UTSW 4 82900426 missense probably damaging 0.98
PIT4531001:Frem1 UTSW 4 82950280 missense probably benign 0.12
R0010:Frem1 UTSW 4 83000098 missense probably benign 0.41
R0010:Frem1 UTSW 4 83000098 missense probably benign 0.41
R0115:Frem1 UTSW 4 82936169 missense possibly damaging 0.94
R0125:Frem1 UTSW 4 83011951 missense probably damaging 1.00
R0280:Frem1 UTSW 4 82969444 missense probably damaging 1.00
R0504:Frem1 UTSW 4 82912637 missense probably benign 0.26
R0519:Frem1 UTSW 4 82970633 critical splice donor site probably null
R0631:Frem1 UTSW 4 82972165 missense probably damaging 1.00
R0645:Frem1 UTSW 4 82989166 missense probably damaging 1.00
R0781:Frem1 UTSW 4 82950320 missense probably damaging 0.99
R1110:Frem1 UTSW 4 82950320 missense probably damaging 0.99
R1115:Frem1 UTSW 4 83020770 missense probably benign 0.28
R1130:Frem1 UTSW 4 82916628 splice site probably null
R1173:Frem1 UTSW 4 82950352 missense probably benign 0.16
R1349:Frem1 UTSW 4 82922305 splice site probably benign
R1464:Frem1 UTSW 4 83011879 missense probably damaging 1.00
R1464:Frem1 UTSW 4 83011879 missense probably damaging 1.00
R1658:Frem1 UTSW 4 83001808 missense probably damaging 1.00
R1672:Frem1 UTSW 4 82998891 missense probably benign 0.09
R1831:Frem1 UTSW 4 83020837 missense possibly damaging 0.95
R1851:Frem1 UTSW 4 82950500 missense probably damaging 0.98
R2014:Frem1 UTSW 4 83005852 missense probably damaging 1.00
R2021:Frem1 UTSW 4 82913558 missense probably benign 0.02
R2022:Frem1 UTSW 4 82913558 missense probably benign 0.02
R2023:Frem1 UTSW 4 82913558 missense probably benign 0.02
R2183:Frem1 UTSW 4 82991495 missense probably benign 0.00
R2437:Frem1 UTSW 4 83000173 missense probably damaging 1.00
R2520:Frem1 UTSW 4 82950290 missense probably damaging 0.99
R3195:Frem1 UTSW 4 83014114 missense probably damaging 0.99
R3196:Frem1 UTSW 4 83014114 missense probably damaging 0.99
R3408:Frem1 UTSW 4 83011986 missense probably damaging 1.00
R3411:Frem1 UTSW 4 82963179 missense possibly damaging 0.51
R3742:Frem1 UTSW 4 83011867 missense probably damaging 1.00
R3829:Frem1 UTSW 4 82998930 missense probably damaging 1.00
R3888:Frem1 UTSW 4 82913607 missense probably benign 0.41
R4329:Frem1 UTSW 4 82986537 missense probably benign 0.01
R4364:Frem1 UTSW 4 82913251 missense probably damaging 0.99
R4411:Frem1 UTSW 4 82963244 missense probably damaging 1.00
R4624:Frem1 UTSW 4 82989106 missense probably damaging 1.00
R4687:Frem1 UTSW 4 83020631 missense probably damaging 1.00
R4764:Frem1 UTSW 4 82989189 missense probably damaging 1.00
R4801:Frem1 UTSW 4 82916628 splice site probably benign
R4802:Frem1 UTSW 4 82916628 splice site probably benign
R4854:Frem1 UTSW 4 82916758 missense possibly damaging 0.88
R4872:Frem1 UTSW 4 82963150 missense probably damaging 1.00
R4947:Frem1 UTSW 4 82966134 missense probably damaging 0.99
R5007:Frem1 UTSW 4 82940812 intron probably benign
R5103:Frem1 UTSW 4 82991612 missense probably benign
R5369:Frem1 UTSW 4 83001739 missense possibly damaging 0.61
R5494:Frem1 UTSW 4 82940753 makesense probably null
R5694:Frem1 UTSW 4 82994116 missense probably damaging 1.00
R5780:Frem1 UTSW 4 82950415 missense probably benign 0.12
R5813:Frem1 UTSW 4 83000158 missense probably damaging 1.00
R5843:Frem1 UTSW 4 82936052 missense probably damaging 1.00
R5914:Frem1 UTSW 4 83001775 missense probably damaging 1.00
R5985:Frem1 UTSW 4 82966050 missense probably benign
R6091:Frem1 UTSW 4 82900559 missense probably benign 0.01
R6165:Frem1 UTSW 4 82956255 missense probably benign 0.16
R6324:Frem1 UTSW 4 82983337 missense probably benign 0.00
R6369:Frem1 UTSW 4 82913792 intron probably null
R6414:Frem1 UTSW 4 82940536 missense probably damaging 0.98
R6421:Frem1 UTSW 4 82994128 missense probably damaging 1.00
R6434:Frem1 UTSW 4 82966016 missense probably benign 0.03
R6453:Frem1 UTSW 4 82914825 nonsense probably null
R6598:Frem1 UTSW 4 83013828 missense probably damaging 0.99
R6720:Frem1 UTSW 4 83013832 missense probably damaging 0.98
R6862:Frem1 UTSW 4 83012014 nonsense probably null
R6922:Frem1 UTSW 4 82922269 missense probably damaging 1.00
R6992:Frem1 UTSW 4 82940362 missense possibly damaging 0.62
R6995:Frem1 UTSW 4 82986601 missense probably damaging 1.00
R7001:Frem1 UTSW 4 82986561 missense probably benign 0.44
R7104:Frem1 UTSW 4 82940681 missense probably benign 0.30
R7146:Frem1 UTSW 4 82922295 missense possibly damaging 0.93
R7174:Frem1 UTSW 4 82922256 missense probably benign 0.00
R7327:Frem1 UTSW 4 83020755 missense possibly damaging 0.87
R7343:Frem1 UTSW 4 82994122 missense probably damaging 0.99
R7368:Frem1 UTSW 4 82966144 missense probably benign 0.19
R7392:Frem1 UTSW 4 83013827 missense probably benign 0.06
X0013:Frem1 UTSW 4 82914808 missense probably benign 0.38
X0017:Frem1 UTSW 4 82991633 critical splice acceptor site probably null
Z1088:Frem1 UTSW 4 82972267 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACAATCTCTTGAACGCATGTG -3'
(R):5'- CAGGCTAAGATGCAAGTGTATG -3'

Sequencing Primer
(F):5'- GTGGTGCCTTGAATATTTTTAAATCC -3'
(R):5'- TTGGACCAGACATTTGGCAC -3'
Posted On2018-11-06