Incidental Mutation 'R6931:Fat3'
ID540030
Institutional Source Beutler Lab
Gene Symbol Fat3
Ensembl Gene ENSMUSG00000074505
Gene NameFAT atypical cadherin 3
Synonyms9430076A06Rik, D430038H04Rik, LOC382129, LOC234973
MMRRC Submission
Accession Numbers

Genbank: NM_001080814; MGI: 2444314

Is this an essential gene? Possibly essential (E-score: 0.606) question?
Stock #R6931 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location15910189-16501285 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 15959942 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 3718 (S3718P)
Ref Sequence ENSEMBL: ENSMUSP00000148968 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082170] [ENSMUST00000217308]
Predicted Effect possibly damaging
Transcript: ENSMUST00000082170
AA Change: S3718P

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000080808
Gene: ENSMUSG00000074505
AA Change: S3718P

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
CA 65 151 3e-7 SMART
CA 175 259 8.9e-22 SMART
CA 280 368 8.9e-4 SMART
CA 389 465 2.6e-11 SMART
CA 489 571 2e-29 SMART
low complexity region 684 697 N/A INTRINSIC
CA 743 824 1e-24 SMART
low complexity region 830 840 N/A INTRINSIC
CA 848 929 7.6e-26 SMART
CA 953 1034 1.5e-25 SMART
CA 1060 1141 6.6e-32 SMART
CA 1165 1247 1.5e-30 SMART
CA 1273 1349 1.8e-8 SMART
CA 1375 1453 2.9e-12 SMART
CA 1477 1559 3e-22 SMART
CA 1583 1664 3.1e-16 SMART
CA 1688 1762 4.2e-22 SMART
CA 1793 1876 2.5e-26 SMART
CA 1900 1975 1.5e-8 SMART
low complexity region 1983 1994 N/A INTRINSIC
CA 1999 2077 1.4e-18 SMART
CA 2101 2179 6.6e-10 SMART
CA 2203 2280 4.9e-19 SMART
CA 2304 2387 4.3e-29 SMART
CA 2411 2489 4.2e-11 SMART
CA 2513 2593 2.8e-22 SMART
CA 2617 2701 4.3e-10 SMART
CA 2719 2807 2.5e-7 SMART
CA 2831 2917 3.3e-27 SMART
CA 2941 3022 9.4e-23 SMART
CA 3046 3124 2.4e-26 SMART
CA 3148 3229 1.3e-32 SMART
CA 3253 3334 1.3e-29 SMART
CA 3358 3439 4.9e-28 SMART
CA 3463 3544 6.4e-12 SMART
EGF 3793 3828 1.3e-1 SMART
LamG 3852 3989 4.3e-25 SMART
EGF 4019 4053 2.7e-6 SMART
EGF 4058 4091 4.5e-6 SMART
EGF_CA 4093 4129 3.9e-11 SMART
transmembrane domain 4151 4170 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000217308
AA Change: S3718P

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)
Meta Mutation Damage Score 0.106 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 99% (77/78)
MGI Phenotype PHENOTYPE: Mice homozgyous for a knock-out allele exhibit abnormal amacrine cell differentiation and migration that result in the formation of two additional plexiform layers and thickened retinal ganglion layer. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Gene trapped(3)

Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik T C 6: 96,165,548 T172A possibly damaging Het
2310003L06Rik T A 5: 87,970,702 I15N probably damaging Het
2900092C05Rik T A 7: 12,512,596 S6R unknown Het
Abca6 T A 11: 110,244,328 L210F probably benign Het
Abcc4 T C 14: 118,527,988 Q919R probably damaging Het
Adcy1 A G 11: 7,150,884 D811G possibly damaging Het
Akna A G 4: 63,387,102 S476P probably benign Het
Ankrd49 T C 9: 14,782,826 N15S probably benign Het
Apcdd1 A G 18: 62,933,908 D31G probably damaging Het
Aplp1 G T 7: 30,443,200 R106S probably damaging Het
Arhgap40 T C 2: 158,531,218 L132S probably benign Het
Atp8b5 G T 4: 43,364,108 probably null Het
Axl T C 7: 25,761,433 D717G probably damaging Het
Bub1 T A 2: 127,801,382 D1014V probably damaging Het
Cacna2d4 T A 6: 119,282,234 V603E possibly damaging Het
Cnot11 G C 1: 39,539,921 C289S probably damaging Het
Coasy A G 11: 101,083,581 H191R probably benign Het
Cyp11a1 A T 9: 58,025,120 N341Y possibly damaging Het
Cyp1a2 T C 9: 57,682,156 N125S probably benign Het
Cyp2j8 A T 4: 96,444,781 probably null Het
Dnah9 A T 11: 66,117,626 I791K possibly damaging Het
Ecm2 A T 13: 49,529,011 Q505H probably benign Het
Fam135a T A 1: 24,085,487 M1L probably damaging Het
Fam171a2 A G 11: 102,438,434 S500P possibly damaging Het
Frem1 G A 4: 82,970,677 P1085S probably damaging Het
Gcfc2 A G 6: 81,942,985 I390V probably benign Het
Gemin4 A G 11: 76,210,956 L993P probably damaging Het
Ggnbp2 T A 11: 84,833,167 D647V probably damaging Het
Gm7534 A T 4: 134,193,153 M567K probably benign Het
Gpr84 A C 15: 103,309,014 L212R probably damaging Het
Hnrnpu T C 1: 178,331,432 probably benign Het
Hspg2 G T 4: 137,540,720 C2116F probably damaging Het
Icam4 T A 9: 21,030,451 V249E probably damaging Het
Itga1 T C 13: 115,001,563 N429D probably benign Het
Kcns1 T C 2: 164,164,838 T402A probably damaging Het
Ky T A 9: 102,537,627 V246E probably damaging Het
March1 A G 8: 66,468,492 T529A probably benign Het
Med18 C G 4: 132,459,883 V102L probably damaging Het
Mlst8 T C 17: 24,477,275 D160G probably damaging Het
Mthfd1 T C 12: 76,303,698 I470T probably benign Het
Muc1 C T 3: 89,229,159 probably benign Het
Mup8 G A 4: 60,220,322 L137F probably damaging Het
Mybpc1 A T 10: 88,542,330 L341* probably null Het
Nacad A G 11: 6,601,877 F438S probably benign Het
Necap2 C A 4: 141,078,212 probably null Het
Nifk T C 1: 118,332,348 L163S possibly damaging Het
Npsr1 A G 9: 24,289,997 I73V probably benign Het
Olfr1179 G A 2: 88,402,064 T290I probably benign Het
Olfr1186 T A 2: 88,526,194 C204S possibly damaging Het
Olfr142 A T 2: 90,252,777 C70* probably null Het
Olfr715 A G 7: 107,128,901 L164P probably damaging Het
Oog3 C T 4: 144,159,353 C225Y probably benign Het
Plagl2 C A 2: 153,235,943 K39N probably benign Het
Plcg2 T A 8: 117,557,319 D118E probably benign Het
Ppp4r3b A T 11: 29,211,786 K720I possibly damaging Het
Prmt3 A T 7: 49,829,016 T442S probably benign Het
Prr14l G A 5: 32,830,691 H487Y probably damaging Het
Psmb3 G A 11: 97,703,971 V63I probably benign Het
Psmc6 T A 14: 45,343,725 I326K possibly damaging Het
Ptcd1 T C 5: 145,155,075 T405A probably benign Het
Rbm33 G A 5: 28,410,745 V29M probably damaging Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Scarb1 T A 5: 125,284,719 I107F probably damaging Het
Slc39a12 A G 2: 14,389,375 S19G probably benign Het
Slc44a5 T C 3: 154,258,506 V503A probably benign Het
Slc9a9 T C 9: 94,670,086 S9P possibly damaging Het
Snrnp35 A C 5: 124,490,701 R192S possibly damaging Het
Tbx15 T C 3: 99,352,151 L446P probably damaging Het
Tlnrd1 A G 7: 83,882,597 F209L probably benign Het
Tmprss12 C T 15: 100,285,268 R164C probably damaging Het
Tnfsf4 T A 1: 161,417,073 F111Y possibly damaging Het
Trib2 A T 12: 15,793,639 M198K probably benign Het
Ttll8 A G 15: 88,914,304 S743P possibly damaging Het
Ush2a A T 1: 188,728,383 N2614Y probably benign Het
Usp6nl G A 2: 6,430,458 V343I possibly damaging Het
Vrtn C A 12: 84,650,242 Q589K probably benign Het
Zbed5 T A 5: 129,903,329 Y706* probably null Het
Zc3h10 A G 10: 128,544,684 V268A probably damaging Het
Zfp442 C T 2: 150,410,940 probably null Het
Other mutations in Fat3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00662:Fat3 APN 9 15996427 missense possibly damaging 0.77
IGL00962:Fat3 APN 9 15915519 missense probably benign 0.14
IGL00966:Fat3 APN 9 15999094 missense possibly damaging 0.69
IGL01100:Fat3 APN 9 16375228 missense probably damaging 1.00
IGL01104:Fat3 APN 9 16375728 missense possibly damaging 0.92
IGL01104:Fat3 APN 9 15998460 missense probably damaging 1.00
IGL01121:Fat3 APN 9 15998401 missense probably benign 0.00
IGL01407:Fat3 APN 9 16378023 missense probably benign 0.01
IGL01444:Fat3 APN 9 15998848 missense probably damaging 1.00
IGL01634:Fat3 APN 9 15998358 missense probably damaging 1.00
IGL01649:Fat3 APN 9 16376719 missense possibly damaging 0.95
IGL01839:Fat3 APN 9 15997872 missense probably damaging 1.00
IGL01867:Fat3 APN 9 16377901 missense probably benign 0.03
IGL01894:Fat3 APN 9 16375849 missense probably benign
IGL01913:Fat3 APN 9 15998790 missense probably damaging 0.99
IGL02033:Fat3 APN 9 15915352 missense possibly damaging 0.50
IGL02035:Fat3 APN 9 16377970 missense probably benign 0.06
IGL02146:Fat3 APN 9 15999582 missense probably benign
IGL02147:Fat3 APN 9 15995985 missense probably damaging 1.00
IGL02161:Fat3 APN 9 15997050 missense probably benign 0.10
IGL02161:Fat3 APN 9 15997051 nonsense probably null
IGL02164:Fat3 APN 9 16031424 splice site probably benign
IGL02269:Fat3 APN 9 15915577 missense possibly damaging 0.84
IGL02314:Fat3 APN 9 15969838 missense possibly damaging 0.61
IGL02393:Fat3 APN 9 15988412 nonsense probably null
IGL02410:Fat3 APN 9 15997845 missense probably damaging 1.00
IGL02504:Fat3 APN 9 15959798 missense probably damaging 1.00
IGL02572:Fat3 APN 9 15960506 missense probably benign
IGL02623:Fat3 APN 9 15997137 missense probably damaging 1.00
IGL02654:Fat3 APN 9 15996975 missense possibly damaging 0.84
IGL02749:Fat3 APN 9 16006711 missense possibly damaging 0.93
IGL02810:Fat3 APN 9 16376850 missense probably damaging 1.00
IGL02839:Fat3 APN 9 15919170 missense probably damaging 1.00
IGL02890:Fat3 APN 9 15915340 missense probably benign 0.03
IGL02892:Fat3 APN 9 16377562 missense probably damaging 1.00
IGL03090:Fat3 APN 9 16377239 nonsense probably null
IGL03144:Fat3 APN 9 16375245 missense probably damaging 1.00
IGL03199:Fat3 APN 9 16377048 missense possibly damaging 0.83
IGL03365:Fat3 APN 9 15996469 missense probably damaging 1.00
IGL03392:Fat3 APN 9 16003862 missense probably benign
IGL03408:Fat3 APN 9 15997957 nonsense probably null
gagged UTSW 9 15998271 missense probably damaging 1.00
Muffled UTSW 9 15937991 critical splice donor site probably null
softened UTSW 9 16378185 missense probably benign
F6893:Fat3 UTSW 9 16006789 missense probably damaging 0.99
IGL03050:Fat3 UTSW 9 15996600 missense probably benign 0.04
PIT4142001:Fat3 UTSW 9 15992118 critical splice donor site probably null
PIT4283001:Fat3 UTSW 9 16006601 missense possibly damaging 0.77
PIT4378001:Fat3 UTSW 9 16376808 missense probably benign 0.05
PIT4434001:Fat3 UTSW 9 15996316 missense probably benign 0.00
PIT4468001:Fat3 UTSW 9 15996351 missense probably benign 0.06
R0001:Fat3 UTSW 9 16377873 missense probably damaging 0.99
R0005:Fat3 UTSW 9 15962866 missense probably damaging 1.00
R0005:Fat3 UTSW 9 15962866 missense probably damaging 1.00
R0038:Fat3 UTSW 9 15915010 missense probably damaging 1.00
R0046:Fat3 UTSW 9 15965979 missense possibly damaging 0.65
R0089:Fat3 UTSW 9 15938205 missense probably benign
R0135:Fat3 UTSW 9 16006777 missense probably damaging 1.00
R0255:Fat3 UTSW 9 15969706 splice site probably benign
R0349:Fat3 UTSW 9 16031180 missense probably damaging 1.00
R0361:Fat3 UTSW 9 15998403 missense possibly damaging 0.77
R0382:Fat3 UTSW 9 15959756 missense probably damaging 1.00
R0418:Fat3 UTSW 9 16246896 missense probably damaging 1.00
R0419:Fat3 UTSW 9 15992256 missense probably damaging 1.00
R0437:Fat3 UTSW 9 15996932 missense probably damaging 1.00
R0441:Fat3 UTSW 9 15945008 splice site probably benign
R0480:Fat3 UTSW 9 15997729 missense probably benign 0.00
R0510:Fat3 UTSW 9 15999685 nonsense probably null
R0665:Fat3 UTSW 9 15997402 missense probably benign
R0715:Fat3 UTSW 9 16375123 missense probably benign
R0727:Fat3 UTSW 9 15996699 missense probably damaging 1.00
R0882:Fat3 UTSW 9 16031368 missense possibly damaging 0.84
R0946:Fat3 UTSW 9 15997804 missense possibly damaging 0.95
R1068:Fat3 UTSW 9 15970034 missense probably benign
R1081:Fat3 UTSW 9 16375284 missense possibly damaging 0.62
R1082:Fat3 UTSW 9 16006615 missense probably damaging 1.00
R1148:Fat3 UTSW 9 15996774 missense probably damaging 1.00
R1148:Fat3 UTSW 9 15996774 missense probably damaging 1.00
R1233:Fat3 UTSW 9 15922745 missense probably benign
R1306:Fat3 UTSW 9 16376679 missense probably damaging 1.00
R1311:Fat3 UTSW 9 16021410 missense probably damaging 1.00
R1338:Fat3 UTSW 9 15925091 missense probably benign 0.00
R1395:Fat3 UTSW 9 16246916 missense probably benign 0.00
R1466:Fat3 UTSW 9 16375482 missense probably damaging 0.96
R1466:Fat3 UTSW 9 16375482 missense probably damaging 0.96
R1510:Fat3 UTSW 9 15960055 missense probably damaging 1.00
R1528:Fat3 UTSW 9 15925091 missense probably benign 0.00
R1531:Fat3 UTSW 9 15997465 missense probably damaging 1.00
R1659:Fat3 UTSW 9 15997183 missense possibly damaging 0.91
R1697:Fat3 UTSW 9 15944880 missense probably benign 0.05
R1699:Fat3 UTSW 9 15938398 missense probably damaging 1.00
R1728:Fat3 UTSW 9 15996315 missense possibly damaging 0.65
R1729:Fat3 UTSW 9 15996315 missense possibly damaging 0.65
R1731:Fat3 UTSW 9 15995937 missense probably benign
R1784:Fat3 UTSW 9 15996315 missense possibly damaging 0.65
R1789:Fat3 UTSW 9 16376985 missense probably benign 0.00
R1794:Fat3 UTSW 9 15997136 nonsense probably null
R1794:Fat3 UTSW 9 15997138 missense probably benign 0.15
R1830:Fat3 UTSW 9 15915340 missense probably benign 0.03
R1835:Fat3 UTSW 9 15998088 missense probably damaging 1.00
R1887:Fat3 UTSW 9 15967061 missense probably damaging 1.00
R1898:Fat3 UTSW 9 15960130 missense probably damaging 1.00
R1909:Fat3 UTSW 9 15998115 missense probably benign
R1912:Fat3 UTSW 9 15969988 missense probably damaging 1.00
R1917:Fat3 UTSW 9 15997057 missense possibly damaging 0.55
R1967:Fat3 UTSW 9 15968295 missense probably benign 0.00
R2070:Fat3 UTSW 9 15999370 missense probably benign 0.21
R2100:Fat3 UTSW 9 16377430 missense possibly damaging 0.73
R2104:Fat3 UTSW 9 15998517 missense possibly damaging 0.77
R2113:Fat3 UTSW 9 15999786 missense probably damaging 1.00
R2132:Fat3 UTSW 9 16246719 critical splice donor site probably null
R2136:Fat3 UTSW 9 16377051 missense probably benign 0.01
R2146:Fat3 UTSW 9 15990512 missense probably benign 0.01
R2233:Fat3 UTSW 9 15998271 missense probably damaging 1.00
R2234:Fat3 UTSW 9 15998271 missense probably damaging 1.00
R2273:Fat3 UTSW 9 15915262 missense probably benign
R2285:Fat3 UTSW 9 16376173 missense probably damaging 1.00
R2363:Fat3 UTSW 9 15998271 missense probably damaging 1.00
R2365:Fat3 UTSW 9 15998271 missense probably damaging 1.00
R2367:Fat3 UTSW 9 15998271 missense probably damaging 1.00
R2403:Fat3 UTSW 9 15969871 missense probably damaging 1.00
R2447:Fat3 UTSW 9 15998271 missense probably damaging 1.00
R2496:Fat3 UTSW 9 15966103 missense probably benign 0.01
R2509:Fat3 UTSW 9 15925014 missense possibly damaging 0.82
R2932:Fat3 UTSW 9 16375944 missense probably damaging 1.00
R2986:Fat3 UTSW 9 15992128 missense probably damaging 1.00
R3054:Fat3 UTSW 9 15960496 missense probably benign
R3056:Fat3 UTSW 9 15960496 missense probably benign
R3729:Fat3 UTSW 9 16247041 splice site probably benign
R3745:Fat3 UTSW 9 15998271 missense probably damaging 1.00
R3806:Fat3 UTSW 9 15998271 missense probably damaging 1.00
R3859:Fat3 UTSW 9 15997228 nonsense probably null
R3862:Fat3 UTSW 9 15998271 missense probably damaging 1.00
R3890:Fat3 UTSW 9 15998271 missense probably damaging 1.00
R3892:Fat3 UTSW 9 15998271 missense probably damaging 1.00
R3950:Fat3 UTSW 9 15998271 missense probably damaging 1.00
R3972:Fat3 UTSW 9 15998271 missense probably damaging 1.00
R4004:Fat3 UTSW 9 15998271 missense probably damaging 1.00
R4005:Fat3 UTSW 9 15998271 missense probably damaging 1.00
R4086:Fat3 UTSW 9 15998271 missense probably damaging 1.00
R4111:Fat3 UTSW 9 15998271 missense probably damaging 1.00
R4113:Fat3 UTSW 9 15998271 missense probably damaging 1.00
R4227:Fat3 UTSW 9 16377693 missense probably damaging 1.00
R4352:Fat3 UTSW 9 16246778 missense possibly damaging 0.55
R4394:Fat3 UTSW 9 15922792 missense probably benign 0.11
R4403:Fat3 UTSW 9 15944873 missense probably damaging 1.00
R4433:Fat3 UTSW 9 16031152 missense probably damaging 0.99
R4453:Fat3 UTSW 9 15998271 missense probably damaging 1.00
R4479:Fat3 UTSW 9 15998271 missense probably damaging 1.00
R4480:Fat3 UTSW 9 15998271 missense probably damaging 1.00
R4521:Fat3 UTSW 9 15922942 missense probably null 0.71
R4620:Fat3 UTSW 9 15996894 missense probably damaging 1.00
R4700:Fat3 UTSW 9 16031173 missense probably damaging 1.00
R4721:Fat3 UTSW 9 16029966 missense probably damaging 1.00
R4790:Fat3 UTSW 9 15998484 missense probably damaging 1.00
R4796:Fat3 UTSW 9 15999732 missense probably benign 0.17
R4823:Fat3 UTSW 9 15996507 missense probably benign
R4836:Fat3 UTSW 9 16377723 missense probably damaging 1.00
R4842:Fat3 UTSW 9 15997587 missense probably damaging 1.00
R4849:Fat3 UTSW 9 16377948 missense probably benign 0.03
R4856:Fat3 UTSW 9 16021330 missense probably benign
R4869:Fat3 UTSW 9 16377477 missense probably damaging 0.98
R4886:Fat3 UTSW 9 16021330 missense probably benign
R4899:Fat3 UTSW 9 15969799 missense probably damaging 1.00
R4941:Fat3 UTSW 9 16375152 missense probably damaging 1.00
R4986:Fat3 UTSW 9 15998340 missense probably damaging 1.00
R5058:Fat3 UTSW 9 15996858 missense probably damaging 1.00
R5079:Fat3 UTSW 9 15999127 missense probably benign 0.01
R5080:Fat3 UTSW 9 15999338 missense probably benign 0.35
R5174:Fat3 UTSW 9 15999570 missense probably damaging 1.00
R5183:Fat3 UTSW 9 15960313 missense probably damaging 0.99
R5203:Fat3 UTSW 9 16378142 missense possibly damaging 0.79
R5216:Fat3 UTSW 9 16377537 missense probably damaging 1.00
R5230:Fat3 UTSW 9 15990560 missense possibly damaging 0.51
R5318:Fat3 UTSW 9 16376629 missense probably damaging 1.00
R5377:Fat3 UTSW 9 16376443 missense probably benign 0.05
R5385:Fat3 UTSW 9 15922675 missense possibly damaging 0.82
R5436:Fat3 UTSW 9 15960514 missense probably benign 0.02
R5437:Fat3 UTSW 9 16085308 missense probably damaging 1.00
R5453:Fat3 UTSW 9 15996864 missense probably damaging 1.00
R5460:Fat3 UTSW 9 15919167 missense probably damaging 1.00
R5516:Fat3 UTSW 9 15998709 missense probably damaging 1.00
R5568:Fat3 UTSW 9 16376923 nonsense probably null
R5628:Fat3 UTSW 9 15966096 missense probably damaging 1.00
R5835:Fat3 UTSW 9 16375833 missense probably damaging 1.00
R5845:Fat3 UTSW 9 16377210 missense probably damaging 1.00
R5898:Fat3 UTSW 9 15938461 missense probably benign 0.15
R5941:Fat3 UTSW 9 15999501 missense probably benign 0.07
R5974:Fat3 UTSW 9 16006528 critical splice donor site probably null
R5986:Fat3 UTSW 9 15998317 missense probably benign 0.22
R6015:Fat3 UTSW 9 16376050 missense possibly damaging 0.55
R6031:Fat3 UTSW 9 15988492 missense probably benign 0.02
R6031:Fat3 UTSW 9 15988492 missense probably benign 0.02
R6042:Fat3 UTSW 9 16377817 missense probably benign 0.12
R6051:Fat3 UTSW 9 16375455 missense possibly damaging 0.83
R6052:Fat3 UTSW 9 15922679 missense probably null
R6119:Fat3 UTSW 9 16376568 missense possibly damaging 0.82
R6161:Fat3 UTSW 9 16377522 missense probably damaging 1.00
R6254:Fat3 UTSW 9 15996145 missense probably benign 0.19
R6318:Fat3 UTSW 9 15916984 intron probably benign
R6347:Fat3 UTSW 9 15998372 missense probably damaging 1.00
R6348:Fat3 UTSW 9 15937991 critical splice donor site probably null
R6351:Fat3 UTSW 9 15938398 missense probably damaging 1.00
R6450:Fat3 UTSW 9 15999170 missense possibly damaging 0.51
R6460:Fat3 UTSW 9 15967000 missense probably damaging 1.00
R6524:Fat3 UTSW 9 15992256 missense probably damaging 1.00
R6533:Fat3 UTSW 9 15998899 missense probably benign 0.02
R6565:Fat3 UTSW 9 15915327 missense probably benign
R6576:Fat3 UTSW 9 16377210 missense probably damaging 1.00
R6649:Fat3 UTSW 9 16376742 missense probably damaging 1.00
R6716:Fat3 UTSW 9 15919269 missense probably benign
R6719:Fat3 UTSW 9 15996144 missense probably benign
R6753:Fat3 UTSW 9 15915061 missense possibly damaging 0.82
R6754:Fat3 UTSW 9 15915061 missense possibly damaging 0.82
R6755:Fat3 UTSW 9 15915061 missense possibly damaging 0.82
R6792:Fat3 UTSW 9 16375644 missense probably damaging 1.00
R6802:Fat3 UTSW 9 15915061 missense possibly damaging 0.82
R6803:Fat3 UTSW 9 15996787 missense probably damaging 0.99
R6831:Fat3 UTSW 9 15915061 missense possibly damaging 0.82
R6831:Fat3 UTSW 9 16376551 missense probably damaging 0.98
R6833:Fat3 UTSW 9 15915061 missense possibly damaging 0.82
R6877:Fat3 UTSW 9 15999268 missense probably benign
R6894:Fat3 UTSW 9 15997776 missense probably damaging 1.00
R6915:Fat3 UTSW 9 16377748 missense probably benign 0.37
R6934:Fat3 UTSW 9 16376956 missense probably damaging 0.98
R6940:Fat3 UTSW 9 15916800 intron probably null
R6959:Fat3 UTSW 9 15996885 missense possibly damaging 0.91
R6969:Fat3 UTSW 9 16029916 missense probably benign 0.29
R6986:Fat3 UTSW 9 16021335 missense probably damaging 1.00
R6993:Fat3 UTSW 9 15919221 missense probably damaging 1.00
R7039:Fat3 UTSW 9 16376265 missense probably damaging 1.00
R7051:Fat3 UTSW 9 16377827 missense probably damaging 1.00
R7089:Fat3 UTSW 9 15996918 missense probably benign 0.01
R7136:Fat3 UTSW 9 16378185 missense probably benign
R7137:Fat3 UTSW 9 15997148 missense probably damaging 1.00
R7154:Fat3 UTSW 9 15996864 missense probably damaging 1.00
R7170:Fat3 UTSW 9 16006574 missense probably damaging 0.99
R7183:Fat3 UTSW 9 15922837 missense possibly damaging 0.81
R7237:Fat3 UTSW 9 16377214 missense probably damaging 1.00
R7288:Fat3 UTSW 9 15998592 missense probably damaging 1.00
R7293:Fat3 UTSW 9 15915040 missense
R7293:Fat3 UTSW 9 15915296 missense
R7381:Fat3 UTSW 9 16246987 missense probably damaging 1.00
R7438:Fat3 UTSW 9 15988482 missense probably benign
X0021:Fat3 UTSW 9 16029931 missense probably null 0.66
X0026:Fat3 UTSW 9 15996333 missense probably benign
X0064:Fat3 UTSW 9 15919277 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACGTTCCTATAGAAACGTGGACAC -3'
(R):5'- CCATCCGCTTTGAAGATGTGTC -3'

Sequencing Primer
(F):5'- TGGACACACGAAGCTGATGC -3'
(R):5'- CTTTGAAGATGTGTCCCCAGAG -3'
Posted On2018-11-06