Incidental Mutation 'R6932:Mcm9'
ID540108
Institutional Source Beutler Lab
Gene Symbol Mcm9
Ensembl Gene ENSMUSG00000058298
Gene Nameminichromosome maintenance 9 homologous recombination repair factor
SynonymsMcmdc1, 9030408O17Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6932 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location53536315-53630439 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 53620203 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 368 (S368P)
Ref Sequence ENSEMBL: ENSMUSP00000074978 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075540] [ENSMUST00000219838]
Predicted Effect probably benign
Transcript: ENSMUST00000075540
AA Change: S368P

PolyPhen 2 Score 0.059 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000074978
Gene: ENSMUSG00000058298
AA Change: S368P

DomainStartEndE-ValueType
low complexity region 22 44 N/A INTRINSIC
low complexity region 62 79 N/A INTRINSIC
low complexity region 81 111 N/A INTRINSIC
MCM 268 761 9.44e-116 SMART
AAA 500 649 2.43e-6 SMART
coiled coil region 789 817 N/A INTRINSIC
low complexity region 884 895 N/A INTRINSIC
low complexity region 1004 1028 N/A INTRINSIC
low complexity region 1045 1056 N/A INTRINSIC
low complexity region 1199 1216 N/A INTRINSIC
low complexity region 1219 1232 N/A INTRINSIC
low complexity region 1246 1255 N/A INTRINSIC
low complexity region 1262 1276 N/A INTRINSIC
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000219838
AA Change: S368P

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.2%
Validation Efficiency 98% (80/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the mini-chromosome maintenance (MCM) protein family that are essential for the initiation of eukaryotic genome replication. Binding of this protein to chromatin has been shown to be a pre-requisite for recruiting the MCM2-7 helicase to DNA replication origins. This protein also binds, and is a positive regulator of, the chromatin licensing and DNA replication factor 1, CDT1. [provided by RefSeq, Nov 2010]
PHENOTYPE: Mice homozygous for gene trap alleles display germ cell loss with reduced fertility or infertility and increased tumor incidence, particulary of hepatocellular carcinomas. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932443I19Rik CA CAA 8: 13,734,865 probably null Het
Acads A T 5: 115,112,272 F198I probably damaging Het
Acy1 A G 9: 106,437,627 probably null Het
Adk A G 14: 21,076,308 M1V probably null Het
Ahi1 A G 10: 20,963,691 D167G probably benign Het
Ankrd16 T C 2: 11,786,243 V290A possibly damaging Het
Arhgef5 T A 6: 43,274,417 S701T possibly damaging Het
Atp13a5 C A 16: 29,281,951 M673I probably damaging Het
BC005624 T C 2: 30,978,928 D78G possibly damaging Het
Bcat2 C T 7: 45,589,321 H347Y probably damaging Het
Bpifb4 A G 2: 153,942,627 Y85C possibly damaging Het
Cdc42 T A 4: 137,322,621 probably null Het
Cep170 G A 1: 176,761,437 L541F possibly damaging Het
Cgrrf1 T A 14: 46,853,722 N234K probably benign Het
Ctrc C T 4: 141,841,568 C108Y probably damaging Het
Cyp2u1 C T 3: 131,298,296 V192M possibly damaging Het
Dhx38 A T 8: 109,552,675 L1013Q probably damaging Het
Dnah1 T A 14: 31,287,776 N1945I probably damaging Het
Dnah10 C G 5: 124,821,450 N3765K possibly damaging Het
Dnah17 C A 11: 118,060,079 R2906L possibly damaging Het
Dnajc10 C T 2: 80,331,336 T306I probably benign Het
Efemp2 T A 19: 5,480,245 C287S probably damaging Het
Efna1 T C 3: 89,272,784 R143G probably benign Het
Emilin1 A C 5: 30,917,077 N221H probably damaging Het
Epg5 A G 18: 77,948,609 T174A probably benign Het
Fam184b T A 5: 45,532,901 probably null Het
Fchsd2 T A 7: 101,277,414 C570* probably null Het
Gm4787 A T 12: 81,379,200 D61E probably benign Het
Gm7356 C T 17: 14,001,663 G35R probably damaging Het
Gm8220 A G 14: 44,288,188 T20A probably damaging Het
Hivep2 C T 10: 14,128,501 T281M probably damaging Het
Ighv2-9-1 A G 12: 113,770,072 V43A probably damaging Het
Klhl33 A T 14: 50,891,916 C619S probably benign Het
Kmt2a A T 9: 44,829,261 probably benign Het
Lax1 A G 1: 133,680,158 C282R probably benign Het
Lrrd1 A G 5: 3,851,395 K567E probably benign Het
Luzp1 C T 4: 136,540,813 R116* probably null Het
Lypd3 G C 7: 24,638,433 G75R probably damaging Het
Macrod2 A T 2: 140,419,913 N38I probably damaging Het
Map3k14 A T 11: 103,242,132 I80N probably damaging Het
Mfge8 T C 7: 79,143,301 D139G probably benign Het
Mmp19 A T 10: 128,791,654 I54F probably benign Het
Myo15 G T 11: 60,499,494 W2114L probably damaging Het
Myo1a G T 10: 127,710,458 V277L probably benign Het
Myoc A G 1: 162,639,346 D28G probably damaging Het
Myrf G T 19: 10,219,560 N487K probably damaging Het
Olfr1093 C G 2: 86,786,155 L142V probably damaging Het
Olfr429 G A 1: 174,089,750 A237T probably damaging Het
Olfr703 G T 7: 106,844,802 G64* probably null Het
Omd T A 13: 49,590,234 F253L probably damaging Het
Papss1 T G 3: 131,599,971 I238S probably damaging Het
Pkhd1 A T 1: 20,562,451 F580Y probably benign Het
Polk T A 13: 96,516,681 K70N probably damaging Het
Ppig T A 2: 69,732,411 D31E probably benign Het
Ppp6r1 G T 7: 4,633,292 S766R possibly damaging Het
Rab11fip5 T C 6: 85,341,558 D783G probably benign Het
Reln T C 5: 21,985,857 I1511V probably benign Het
Rnh1 T C 7: 141,163,183 N268S probably damaging Het
Rpia A G 6: 70,773,440 V236A probably benign Het
Rpl10a G T 17: 28,329,450 V80L probably benign Het
Sap130 T G 18: 31,666,354 S295A possibly damaging Het
Sgms1 C T 19: 32,142,793 V238I probably benign Het
Sh3tc1 A G 5: 35,707,434 S470P probably benign Het
Slc25a32 A G 15: 39,097,589 V233A possibly damaging Het
Slc2a2 T C 3: 28,717,519 S158P probably benign Het
Slc6a2 A G 8: 92,996,025 Y550C probably benign Het
Slc7a9 C A 7: 35,452,511 T77K probably benign Het
Snd1 A T 6: 28,626,101 D385V probably benign Het
Ssh3 A T 19: 4,264,420 F369I probably damaging Het
Syk A G 13: 52,612,459 probably null Het
Tbc1d16 A G 11: 119,208,916 S211P probably damaging Het
Ttc3 A G 16: 94,443,453 T1439A probably benign Het
Usp18 A G 6: 121,252,514 M31V probably benign Het
Vav1 G T 17: 57,302,330 E415D possibly damaging Het
Vps13a A T 19: 16,678,075 V1863D probably benign Het
Xdh T A 17: 73,922,562 I299F probably damaging Het
Zc3h14 A G 12: 98,771,077 probably benign Het
Zfp345 G A 2: 150,473,411 H69Y probably damaging Het
Zfp652 G T 11: 95,763,841 V357L probably benign Het
Zfp712 A T 13: 67,040,827 Y545* probably null Het
Zgrf1 T C 3: 127,559,632 probably null Het
Other mutations in Mcm9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00660:Mcm9 APN 10 53622973 missense probably damaging 0.97
IGL00904:Mcm9 APN 10 53622921 missense possibly damaging 0.89
IGL00943:Mcm9 APN 10 53548589 missense probably damaging 1.00
IGL01019:Mcm9 APN 10 53629945 missense probably damaging 1.00
IGL02452:Mcm9 APN 10 53541557 missense probably damaging 1.00
IGL02481:Mcm9 APN 10 53625937 missense probably damaging 1.00
IGL02982:Mcm9 APN 10 53625826 missense probably damaging 0.99
IGL03300:Mcm9 APN 10 53611427 missense probably damaging 1.00
R0021:Mcm9 UTSW 10 53537901 missense possibly damaging 0.94
R0117:Mcm9 UTSW 10 53537736 missense possibly damaging 0.49
R0137:Mcm9 UTSW 10 53563430 missense possibly damaging 0.95
R0420:Mcm9 UTSW 10 53548527 missense probably benign 0.10
R0499:Mcm9 UTSW 10 53538154 missense probably benign 0.01
R0543:Mcm9 UTSW 10 53541598 missense probably damaging 0.97
R0947:Mcm9 UTSW 10 53537501 small deletion probably benign
R0975:Mcm9 UTSW 10 53538646 nonsense probably null
R1573:Mcm9 UTSW 10 53548656 missense probably damaging 0.97
R1726:Mcm9 UTSW 10 53537881 missense possibly damaging 0.67
R1839:Mcm9 UTSW 10 53541553 missense probably damaging 0.99
R2050:Mcm9 UTSW 10 53612825 critical splice donor site probably null
R2113:Mcm9 UTSW 10 53615847 splice site probably null
R2172:Mcm9 UTSW 10 53548574 missense probably damaging 1.00
R3417:Mcm9 UTSW 10 53537407 missense possibly damaging 0.83
R3755:Mcm9 UTSW 10 53625952 missense probably benign 0.08
R3787:Mcm9 UTSW 10 53615980 missense possibly damaging 0.78
R3789:Mcm9 UTSW 10 53616017 missense probably damaging 1.00
R3953:Mcm9 UTSW 10 53563344 missense probably damaging 1.00
R4291:Mcm9 UTSW 10 53547572 missense probably benign 0.22
R4358:Mcm9 UTSW 10 53537653 missense probably benign 0.03
R4660:Mcm9 UTSW 10 53548527 missense probably benign 0.10
R4662:Mcm9 UTSW 10 53548527 missense probably benign 0.10
R5082:Mcm9 UTSW 10 53538060 missense possibly damaging 0.94
R5130:Mcm9 UTSW 10 53630399 missense possibly damaging 0.90
R5193:Mcm9 UTSW 10 53616038 missense probably damaging 0.99
R5238:Mcm9 UTSW 10 53629997 missense possibly damaging 0.83
R5317:Mcm9 UTSW 10 53538234 missense probably damaging 1.00
R5395:Mcm9 UTSW 10 53538692 missense possibly damaging 0.93
R5524:Mcm9 UTSW 10 53548690 nonsense probably null
R5593:Mcm9 UTSW 10 53538297 missense probably damaging 0.99
R5748:Mcm9 UTSW 10 53625729 missense probably damaging 1.00
R6025:Mcm9 UTSW 10 53615977 missense possibly damaging 0.93
R6299:Mcm9 UTSW 10 53537681 missense probably damaging 1.00
R6344:Mcm9 UTSW 10 53537937 missense probably benign 0.03
R6502:Mcm9 UTSW 10 53612839 missense probably damaging 1.00
R6621:Mcm9 UTSW 10 53563313 missense probably damaging 1.00
R6883:Mcm9 UTSW 10 53616014 missense probably damaging 1.00
R6963:Mcm9 UTSW 10 53548617 missense probably damaging 1.00
R7094:Mcm9 UTSW 10 53620157 missense probably damaging 1.00
R7114:Mcm9 UTSW 10 53538573 missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- TACTCTTGCTGGCTACATACAG -3'
(R):5'- TGAAGTCTGAAGCTGGTATTAGTC -3'

Sequencing Primer
(F):5'- ATCTATAGCCCCAACTGCTGG -3'
(R):5'- TGGAAGCAGTTTCGAGT -3'
Posted On2018-11-06