Incidental Mutation 'R6934:1700018B08Rik'
ID540205
Institutional Source Beutler Lab
Gene Symbol 1700018B08Rik
Ensembl Gene ENSMUSG00000031809
Gene NameRIKEN cDNA 1700018B08 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #R6934 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location121530780-121544320 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 121539973 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 58 (Y58F)
Ref Sequence ENSEMBL: ENSMUSP00000138106 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034265] [ENSMUST00000127664] [ENSMUST00000182460] [ENSMUST00000182739] [ENSMUST00000183280]
Predicted Effect probably benign
Transcript: ENSMUST00000034265
AA Change: Y39F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000034265
Gene: ENSMUSG00000031809
AA Change: Y39F

DomainStartEndE-ValueType
Pfam:DUF4568 3 213 1.4e-118 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182460
AA Change: Y58F

PolyPhen 2 Score 0.049 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000138106
Gene: ENSMUSG00000031809
AA Change: Y58F

DomainStartEndE-ValueType
Pfam:DUF4568 23 188 7.2e-90 PFAM
Predicted Effect silent
Transcript: ENSMUST00000182739
Predicted Effect unknown
Transcript: ENSMUST00000183280
AA Change: M42L
SMART Domains Protein: ENSMUSP00000138141
Gene: ENSMUSG00000031809
AA Change: M42L

DomainStartEndE-ValueType
Pfam:DUF4568 3 48 2.1e-6 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530003J23Rik C T 10: 117,238,508 D25N probably benign Het
Asap2 T C 12: 21,168,250 V58A probably damaging Het
BC067074 T C 13: 113,369,266 S2310P probably benign Het
Bccip A G 7: 133,720,791 M289V probably benign Het
Bhmt2 A T 13: 93,662,311 I334N probably benign Het
Copa T A 1: 172,110,686 I513N possibly damaging Het
Ctif G A 18: 75,435,360 T569M probably benign Het
Dennd1a A T 2: 37,801,213 M231K possibly damaging Het
Dnah3 A G 7: 120,054,601 probably null Het
Fat3 T C 9: 16,376,956 I424V probably damaging Het
Foxred2 G T 15: 77,952,330 C328* probably null Het
Gemin5 A T 11: 58,147,912 H590Q probably damaging Het
Gm5475 T C 15: 100,427,126 probably benign Het
Gmip A G 8: 69,820,926 T956A probably benign Het
Hmbox1 A T 14: 64,896,832 D106E probably benign Het
Irs2 A T 8: 11,004,697 I1245N probably damaging Het
Kcnk1 A G 8: 126,025,390 Y245C probably damaging Het
Krtap4-9 A T 11: 99,785,882 R210* probably null Het
Lama1 A G 17: 67,774,543 D1325G probably benign Het
Mep1a A T 17: 43,482,230 V361E probably damaging Het
Mrgprx2 A G 7: 48,482,065 I92T possibly damaging Het
Nup214 A T 2: 31,982,671 R242* probably null Het
Nynrin T G 14: 55,863,878 S335A probably benign Het
Olfr484 A G 7: 108,124,819 V148A probably benign Het
Olfr538 T G 7: 140,574,651 L166R probably damaging Het
Olfr905 T G 9: 38,473,176 I143S probably benign Het
Orc2 T C 1: 58,500,364 K39E probably benign Het
Ppl C T 16: 5,094,509 G736D probably benign Het
Ppp2r1a A G 17: 20,961,633 E471G possibly damaging Het
Prrc2c G A 1: 162,720,505 P161S probably benign Het
Rnf213 A G 11: 119,420,067 I804V probably benign Het
Saal1 A G 7: 46,702,664 C144R probably benign Het
Slc29a4 G A 5: 142,712,958 V125I probably benign Het
Smarcc2 A G 10: 128,469,672 T322A probably benign Het
Srgap2 A T 1: 131,317,231 M591K possibly damaging Het
Stard9 A G 2: 120,697,695 I1478V probably benign Het
Tet2 A G 3: 133,483,237 probably null Het
Tmem150c C T 5: 100,095,606 probably null Het
Tmem39b T A 4: 129,678,573 H412L possibly damaging Het
Tox A C 4: 6,697,635 H389Q probably damaging Het
Trank1 T C 9: 111,373,090 I1595T probably damaging Het
Vmn2r-ps117 T G 17: 18,824,705 Y461* probably null Het
Vps13a T C 19: 16,676,194 H1941R probably damaging Het
Other mutations in 1700018B08Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02700:1700018B08Rik APN 8 121535422 critical splice donor site probably null
IGL03124:1700018B08Rik APN 8 121541710 splice site probably benign
R1475:1700018B08Rik UTSW 8 121540588 splice site probably benign
R2883:1700018B08Rik UTSW 8 121539905 missense probably damaging 1.00
R3967:1700018B08Rik UTSW 8 121539980 missense possibly damaging 0.52
R6281:1700018B08Rik UTSW 8 121531881 missense probably damaging 1.00
R6490:1700018B08Rik UTSW 8 121540554 missense probably benign 0.06
R6920:1700018B08Rik UTSW 8 121535421 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGTATTGCAGAAACCTCAGTCACAG -3'
(R):5'- AAACAGCCATGTAGCCGCAG -3'

Sequencing Primer
(F):5'- ATCTATGACTTCAATGGGCTCTGGAC -3'
(R):5'- AGCCTCATTCTGAGTCACAGG -3'
Posted On2018-11-06