Incidental Mutation 'R6934:Krtap4-9'
ID540213
Institutional Source Beutler Lab
Gene Symbol Krtap4-9
Ensembl Gene ENSMUSG00000078262
Gene Namekeratin associated protein 4-9
SynonymsOTTMUSG00000002198
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R6934 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location99785200-99786258 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 99785882 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 210 (R210*)
Ref Sequence ENSEMBL: ENSMUSP00000100680 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105059]
Predicted Effect probably null
Transcript: ENSMUST00000105059
AA Change: R210*
SMART Domains Protein: ENSMUSP00000100680
Gene: ENSMUSG00000078262
AA Change: R210*

DomainStartEndE-ValueType
Pfam:Keratin_B2_2 1 47 1.2e-8 PFAM
Pfam:Keratin_B2_2 14 58 4.4e-13 PFAM
Pfam:Keratin_B2_2 54 102 3e-10 PFAM
Pfam:Keratin_B2_2 87 132 8.4e-12 PFAM
Pfam:Keratin_B2_2 98 147 3.4e-9 PFAM
Pfam:Keratin_B2_2 138 182 3.1e-12 PFAM
Pfam:Keratin_B2_2 178 222 4.8e-12 PFAM
Pfam:Keratin_B2_2 203 244 4.9e-9 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018B08Rik T A 8: 121,539,973 Y58F probably benign Het
9530003J23Rik C T 10: 117,238,508 D25N probably benign Het
Asap2 T C 12: 21,168,250 V58A probably damaging Het
BC067074 T C 13: 113,369,266 S2310P probably benign Het
Bccip A G 7: 133,720,791 M289V probably benign Het
Bhmt2 A T 13: 93,662,311 I334N probably benign Het
Copa T A 1: 172,110,686 I513N possibly damaging Het
Ctif G A 18: 75,435,360 T569M probably benign Het
Dennd1a A T 2: 37,801,213 M231K possibly damaging Het
Dnah3 A G 7: 120,054,601 probably null Het
Fat3 T C 9: 16,376,956 I424V probably damaging Het
Foxred2 G T 15: 77,952,330 C328* probably null Het
Gemin5 A T 11: 58,147,912 H590Q probably damaging Het
Gm5475 T C 15: 100,427,126 probably benign Het
Gmip A G 8: 69,820,926 T956A probably benign Het
Hmbox1 A T 14: 64,896,832 D106E probably benign Het
Irs2 A T 8: 11,004,697 I1245N probably damaging Het
Kcnk1 A G 8: 126,025,390 Y245C probably damaging Het
Lama1 A G 17: 67,774,543 D1325G probably benign Het
Mep1a A T 17: 43,482,230 V361E probably damaging Het
Mrgprx2 A G 7: 48,482,065 I92T possibly damaging Het
Nup214 A T 2: 31,982,671 R242* probably null Het
Nynrin T G 14: 55,863,878 S335A probably benign Het
Olfr484 A G 7: 108,124,819 V148A probably benign Het
Olfr538 T G 7: 140,574,651 L166R probably damaging Het
Olfr905 T G 9: 38,473,176 I143S probably benign Het
Orc2 T C 1: 58,500,364 K39E probably benign Het
Ppl C T 16: 5,094,509 G736D probably benign Het
Ppp2r1a A G 17: 20,961,633 E471G possibly damaging Het
Prrc2c G A 1: 162,720,505 P161S probably benign Het
Rnf213 A G 11: 119,420,067 I804V probably benign Het
Saal1 A G 7: 46,702,664 C144R probably benign Het
Slc29a4 G A 5: 142,712,958 V125I probably benign Het
Smarcc2 A G 10: 128,469,672 T322A probably benign Het
Srgap2 A T 1: 131,317,231 M591K possibly damaging Het
Stard9 A G 2: 120,697,695 I1478V probably benign Het
Tet2 A G 3: 133,483,237 probably null Het
Tmem150c C T 5: 100,095,606 probably null Het
Tmem39b T A 4: 129,678,573 H412L possibly damaging Het
Tox A C 4: 6,697,635 H389Q probably damaging Het
Trank1 T C 9: 111,373,090 I1595T probably damaging Het
Vmn2r-ps117 T G 17: 18,824,705 Y461* probably null Het
Vps13a T C 19: 16,676,194 H1941R probably damaging Het
Other mutations in Krtap4-9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01949:Krtap4-9 APN 11 99785565 unclassified probably benign
IGL02697:Krtap4-9 APN 11 99785748 missense unknown
IGL03176:Krtap4-9 APN 11 99785280 unclassified probably benign
R0988:Krtap4-9 UTSW 11 99785536 nonsense probably null
R1773:Krtap4-9 UTSW 11 99785570 unclassified probably benign
R1838:Krtap4-9 UTSW 11 99785396 unclassified probably benign
R2566:Krtap4-9 UTSW 11 99785666 unclassified probably benign
R2888:Krtap4-9 UTSW 11 99785419 nonsense probably null
R3757:Krtap4-9 UTSW 11 99785618 unclassified probably benign
R4633:Krtap4-9 UTSW 11 99785554 unclassified probably benign
R5930:Krtap4-9 UTSW 11 99785636 unclassified probably benign
R6092:Krtap4-9 UTSW 11 99785655 unclassified probably benign
R6501:Krtap4-9 UTSW 11 99785429 unclassified probably benign
R7131:Krtap4-9 UTSW 11 99785457 missense unknown
Predicted Primers PCR Primer
(F):5'- AGCTGCTGTGGATCTAGCTG -3'
(R):5'- GTGGGCTTGCATTCACATATGG -3'

Sequencing Primer
(F):5'- CTGTGGATCTAGCTGCTGCC -3'
(R):5'- CATATGGTCTACATCAGGAATGCTGG -3'
Posted On2018-11-06