Incidental Mutation 'R6934:Foxred2'
ID540220
Institutional Source Beutler Lab
Gene Symbol Foxred2
Ensembl Gene ENSMUSG00000016552
Gene NameFAD-dependent oxidoreductase domain containing 2
SynonymsD15Bwg0759e, A430097D04Rik, LOC239554
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6934 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location77940522-77956722 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 77952330 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 328 (C328*)
Ref Sequence ENSEMBL: ENSMUSP00000113403 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016696] [ENSMUST00000117725]
Predicted Effect probably null
Transcript: ENSMUST00000016696
AA Change: C328*
SMART Domains Protein: ENSMUSP00000016696
Gene: ENSMUSG00000016552
AA Change: C328*

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Pyr_redox_2 22 243 2.9e-11 PFAM
Pfam:Pyr_redox_3 25 240 9.3e-35 PFAM
Pfam:NAD_binding_8 26 84 3.3e-6 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000117725
AA Change: C328*
SMART Domains Protein: ENSMUSP00000113403
Gene: ENSMUSG00000016552
AA Change: C328*

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Pyr_redox_2 23 478 3.4e-9 PFAM
Pfam:Pyr_redox_3 25 240 6.2e-37 PFAM
Pfam:NAD_binding_8 26 90 4.8e-7 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018B08Rik T A 8: 121,539,973 Y58F probably benign Het
9530003J23Rik C T 10: 117,238,508 D25N probably benign Het
Asap2 T C 12: 21,168,250 V58A probably damaging Het
BC067074 T C 13: 113,369,266 S2310P probably benign Het
Bccip A G 7: 133,720,791 M289V probably benign Het
Bhmt2 A T 13: 93,662,311 I334N probably benign Het
Copa T A 1: 172,110,686 I513N possibly damaging Het
Ctif G A 18: 75,435,360 T569M probably benign Het
Dennd1a A T 2: 37,801,213 M231K possibly damaging Het
Dnah3 A G 7: 120,054,601 probably null Het
Fat3 T C 9: 16,376,956 I424V probably damaging Het
Gemin5 A T 11: 58,147,912 H590Q probably damaging Het
Gm5475 T C 15: 100,427,126 probably benign Het
Gmip A G 8: 69,820,926 T956A probably benign Het
Hmbox1 A T 14: 64,896,832 D106E probably benign Het
Irs2 A T 8: 11,004,697 I1245N probably damaging Het
Kcnk1 A G 8: 126,025,390 Y245C probably damaging Het
Krtap4-9 A T 11: 99,785,882 R210* probably null Het
Lama1 A G 17: 67,774,543 D1325G probably benign Het
Mep1a A T 17: 43,482,230 V361E probably damaging Het
Mrgprx2 A G 7: 48,482,065 I92T possibly damaging Het
Nup214 A T 2: 31,982,671 R242* probably null Het
Nynrin T G 14: 55,863,878 S335A probably benign Het
Olfr484 A G 7: 108,124,819 V148A probably benign Het
Olfr538 T G 7: 140,574,651 L166R probably damaging Het
Olfr905 T G 9: 38,473,176 I143S probably benign Het
Orc2 T C 1: 58,500,364 K39E probably benign Het
Ppl C T 16: 5,094,509 G736D probably benign Het
Ppp2r1a A G 17: 20,961,633 E471G possibly damaging Het
Prrc2c G A 1: 162,720,505 P161S probably benign Het
Rnf213 A G 11: 119,420,067 I804V probably benign Het
Saal1 A G 7: 46,702,664 C144R probably benign Het
Slc29a4 G A 5: 142,712,958 V125I probably benign Het
Smarcc2 A G 10: 128,469,672 T322A probably benign Het
Srgap2 A T 1: 131,317,231 M591K possibly damaging Het
Stard9 A G 2: 120,697,695 I1478V probably benign Het
Tet2 A G 3: 133,483,237 probably null Het
Tmem150c C T 5: 100,095,606 probably null Het
Tmem39b T A 4: 129,678,573 H412L possibly damaging Het
Tox A C 4: 6,697,635 H389Q probably damaging Het
Trank1 T C 9: 111,373,090 I1595T probably damaging Het
Vmn2r-ps117 T G 17: 18,824,705 Y461* probably null Het
Vps13a T C 19: 16,676,194 H1941R probably damaging Het
Other mutations in Foxred2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01394:Foxred2 APN 15 77955620 missense probably benign 0.30
IGL01479:Foxred2 APN 15 77952289 splice site probably null
IGL01748:Foxred2 APN 15 77952346 missense probably damaging 1.00
IGL02160:Foxred2 APN 15 77955650 missense probably benign 0.03
IGL02328:Foxred2 APN 15 77955832 missense probably damaging 1.00
IGL02630:Foxred2 APN 15 77947162 missense probably benign 0.05
IGL02672:Foxred2 APN 15 77945577 critical splice donor site probably null
soma UTSW 15 77953358 missense possibly damaging 0.78
R0271:Foxred2 UTSW 15 77943390 missense possibly damaging 0.68
R1386:Foxred2 UTSW 15 77948521 critical splice acceptor site probably null
R1581:Foxred2 UTSW 15 77955761 missense possibly damaging 0.94
R4399:Foxred2 UTSW 15 77953358 missense possibly damaging 0.78
R4399:Foxred2 UTSW 15 77955680 missense probably benign 0.06
R4528:Foxred2 UTSW 15 77943249 missense probably benign 0.01
R4937:Foxred2 UTSW 15 77955835 missense probably damaging 1.00
R5165:Foxred2 UTSW 15 77956012 missense probably damaging 1.00
R5318:Foxred2 UTSW 15 77952398 missense probably benign 0.00
R5893:Foxred2 UTSW 15 77947144 missense probably damaging 1.00
R6336:Foxred2 UTSW 15 77955764 missense probably damaging 0.99
R6370:Foxred2 UTSW 15 77943306 missense probably benign 0.01
R6426:Foxred2 UTSW 15 77953308 missense probably damaging 1.00
R6826:Foxred2 UTSW 15 77947085 missense probably benign 0.01
R6891:Foxred2 UTSW 15 77955709 missense probably damaging 1.00
R7193:Foxred2 UTSW 15 77952030 missense probably damaging 1.00
Z1088:Foxred2 UTSW 15 77952003 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTAGGAACAAGAGCTGCTGG -3'
(R):5'- CATCAACAATGGCCTGCTG -3'

Sequencing Primer
(F):5'- AGCTGCTGGGGACAAGGC -3'
(R):5'- TGAAATCACTAGACGGGCTCCTG -3'
Posted On2018-11-06