Incidental Mutation 'R6934:Mep1a'
ID540225
Institutional Source Beutler Lab
Gene Symbol Mep1a
Ensembl Gene ENSMUSG00000023914
Gene Namemeprin 1 alpha
SynonymsMep-1a, meprin A alpha-subunit, Mep1, meprin alpha, Mep-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6934 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location43474324-43502812 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 43482230 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 361 (V361E)
Ref Sequence ENSEMBL: ENSMUSP00000113838 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024707] [ENSMUST00000117137]
PDB Structure
[]
Predicted Effect probably damaging
Transcript: ENSMUST00000024707
AA Change: V374E

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000024707
Gene: ENSMUSG00000023914
AA Change: V374E

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
ZnMc 83 222 1.16e-41 SMART
MAM 276 445 5.38e-61 SMART
MATH 445 590 6.9e-17 SMART
EGF 687 724 1.35e-2 SMART
transmembrane domain 727 749 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000117137
AA Change: V361E

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000113838
Gene: ENSMUSG00000023914
AA Change: V361E

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
ZnMc 70 209 1.16e-41 SMART
MAM 263 432 5.38e-61 SMART
MATH 432 577 6.9e-17 SMART
EGF 674 711 1.35e-2 SMART
transmembrane domain 714 736 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased litter size, reduced LPS-induced renal injury and bladder inflammation, and increased susceptibility to sodium dextran sulfate-induced colitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018B08Rik T A 8: 121,539,973 Y58F probably benign Het
9530003J23Rik C T 10: 117,238,508 D25N probably benign Het
Asap2 T C 12: 21,168,250 V58A probably damaging Het
BC067074 T C 13: 113,369,266 S2310P probably benign Het
Bccip A G 7: 133,720,791 M289V probably benign Het
Bhmt2 A T 13: 93,662,311 I334N probably benign Het
Copa T A 1: 172,110,686 I513N possibly damaging Het
Ctif G A 18: 75,435,360 T569M probably benign Het
Dennd1a A T 2: 37,801,213 M231K possibly damaging Het
Dnah3 A G 7: 120,054,601 probably null Het
Fat3 T C 9: 16,376,956 I424V probably damaging Het
Foxred2 G T 15: 77,952,330 C328* probably null Het
Gemin5 A T 11: 58,147,912 H590Q probably damaging Het
Gm5475 T C 15: 100,427,126 probably benign Het
Gmip A G 8: 69,820,926 T956A probably benign Het
Hmbox1 A T 14: 64,896,832 D106E probably benign Het
Irs2 A T 8: 11,004,697 I1245N probably damaging Het
Kcnk1 A G 8: 126,025,390 Y245C probably damaging Het
Krtap4-9 A T 11: 99,785,882 R210* probably null Het
Lama1 A G 17: 67,774,543 D1325G probably benign Het
Mrgprx2 A G 7: 48,482,065 I92T possibly damaging Het
Nup214 A T 2: 31,982,671 R242* probably null Het
Nynrin T G 14: 55,863,878 S335A probably benign Het
Olfr484 A G 7: 108,124,819 V148A probably benign Het
Olfr538 T G 7: 140,574,651 L166R probably damaging Het
Olfr905 T G 9: 38,473,176 I143S probably benign Het
Orc2 T C 1: 58,500,364 K39E probably benign Het
Ppl C T 16: 5,094,509 G736D probably benign Het
Ppp2r1a A G 17: 20,961,633 E471G possibly damaging Het
Prrc2c G A 1: 162,720,505 P161S probably benign Het
Rnf213 A G 11: 119,420,067 I804V probably benign Het
Saal1 A G 7: 46,702,664 C144R probably benign Het
Slc29a4 G A 5: 142,712,958 V125I probably benign Het
Smarcc2 A G 10: 128,469,672 T322A probably benign Het
Srgap2 A T 1: 131,317,231 M591K possibly damaging Het
Stard9 A G 2: 120,697,695 I1478V probably benign Het
Tet2 A G 3: 133,483,237 probably null Het
Tmem150c C T 5: 100,095,606 probably null Het
Tmem39b T A 4: 129,678,573 H412L possibly damaging Het
Tox A C 4: 6,697,635 H389Q probably damaging Het
Trank1 T C 9: 111,373,090 I1595T probably damaging Het
Vmn2r-ps117 T G 17: 18,824,705 Y461* probably null Het
Vps13a T C 19: 16,676,194 H1941R probably damaging Het
Other mutations in Mep1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01016:Mep1a APN 17 43479084 missense probably benign 0.00
IGL02814:Mep1a APN 17 43477221 missense probably benign
IGL03000:Mep1a APN 17 43474990 missense probably benign
IGL03335:Mep1a APN 17 43477173 missense possibly damaging 0.63
IGL03410:Mep1a APN 17 43478095 splice site probably null
PIT4544001:Mep1a UTSW 17 43482287 missense probably damaging 1.00
R0127:Mep1a UTSW 17 43497886 splice site probably benign
R0306:Mep1a UTSW 17 43502643 splice site probably benign
R0329:Mep1a UTSW 17 43497898 critical splice donor site probably null
R0330:Mep1a UTSW 17 43497898 critical splice donor site probably null
R0358:Mep1a UTSW 17 43478950 missense possibly damaging 0.92
R0667:Mep1a UTSW 17 43478190 missense probably benign 0.06
R1101:Mep1a UTSW 17 43491693 missense probably benign 0.03
R1458:Mep1a UTSW 17 43491672 missense probably damaging 1.00
R1525:Mep1a UTSW 17 43491636 missense probably damaging 1.00
R1992:Mep1a UTSW 17 43502682 missense probably benign
R2014:Mep1a UTSW 17 43497906 missense probably benign 0.01
R2212:Mep1a UTSW 17 43477263 missense probably benign 0.02
R3946:Mep1a UTSW 17 43475041 nonsense probably null
R4400:Mep1a UTSW 17 43475006 missense possibly damaging 0.77
R4598:Mep1a UTSW 17 43491578 critical splice donor site probably null
R4616:Mep1a UTSW 17 43486241 missense possibly damaging 0.81
R4688:Mep1a UTSW 17 43482248 missense possibly damaging 0.89
R5085:Mep1a UTSW 17 43478144 missense probably damaging 0.99
R5355:Mep1a UTSW 17 43477146 missense probably damaging 0.98
R5832:Mep1a UTSW 17 43478164 missense probably benign 0.27
R5833:Mep1a UTSW 17 43478164 missense probably benign 0.27
R5834:Mep1a UTSW 17 43478164 missense probably benign 0.27
R5835:Mep1a UTSW 17 43478164 missense probably benign 0.27
R6280:Mep1a UTSW 17 43502392 missense probably damaging 1.00
R6340:Mep1a UTSW 17 43479058 missense probably benign 0.00
R6340:Mep1a UTSW 17 43479233 missense probably benign 0.00
R7247:Mep1a UTSW 17 43475104 missense possibly damaging 0.67
Z1088:Mep1a UTSW 17 43491596 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACTTTCCAGGCCTTAAAACCTTC -3'
(R):5'- GGTTGCTCTCTCCATAGGTG -3'

Sequencing Primer
(F):5'- AACCTTCTAATAAAACAGGTCAGAAG -3'
(R):5'- CATAGGTGCCGGCTACTTCATG -3'
Posted On2018-11-06