Incidental Mutation 'R6935:4932443I19Rik'
List |< first << previous [record 34 of 1259] next >> last >|
ID540251
Institutional Source Beutler Lab
Gene Symbol 4932443I19Rik
Ensembl Gene ENSMUSG00000090336
Gene NameRIKEN cDNA 4932443I19 gene
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R6935 (G1)
Quality Score217.468
Status Not validated
Chromosome8
Chromosomal Location13705889-13743414 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) CA to CAA at 13734865 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000153486 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166277] [ENSMUST00000214337]
Predicted Effect probably null
Transcript: ENSMUST00000166277
SMART Domains Protein: ENSMUSP00000127953
Gene: ENSMUSG00000090336

DomainStartEndE-ValueType
Pfam:KIAA1430 26 98 5.3e-15 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000214337
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 97.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930596D02Rik T A 14: 35,811,907 H14L probably benign Het
Adar A G 3: 89,747,218 N368D probably benign Het
Adcy10 T C 1: 165,506,635 V71A probably benign Het
Ank1 C T 8: 23,108,231 T755I probably damaging Het
Aoc1 A T 6: 48,908,227 Y632F probably damaging Het
Bbc3 A G 7: 16,312,199 D20G possibly damaging Het
Bche T G 3: 73,701,800 I98L probably benign Het
Col12a1 A G 9: 79,700,500 Y349H possibly damaging Het
Crip2 T C 12: 113,140,593 C8R probably damaging Het
Dhx58 T A 11: 100,698,406 probably null Het
Dnah2 G A 11: 69,421,741 R4333C probably damaging Het
Dnajb12 T C 10: 59,896,503 probably null Het
Dzank1 T C 2: 144,476,094 E718G possibly damaging Het
Fbxo28 C T 1: 182,341,460 G38R unknown Het
Foxb2 A G 19: 16,872,619 F341S probably benign Het
Gabrb3 T A 7: 57,591,813 I29N probably damaging Het
Gm4881 C A 7: 24,928,561 G181V possibly damaging Het
Gm7298 G A 6: 121,767,694 R557H probably benign Het
Itih3 T A 14: 30,912,702 Q116L possibly damaging Het
Lingo1 T C 9: 56,619,865 Y480C probably damaging Het
Lypd3 G C 7: 24,638,433 G75R probably damaging Het
Mcm3ap C T 10: 76,504,253 P1453S possibly damaging Het
Mdn1 T G 4: 32,774,041 F5551V possibly damaging Het
Myo16 T A 8: 10,569,820 M1457K probably benign Het
Nbeal2 T A 9: 110,639,391 E372V probably damaging Het
Ncam2 T A 16: 81,526,991 S508T probably benign Het
Nebl A T 2: 17,348,826 D971E probably damaging Het
Nlrp10 A T 7: 108,926,900 M77K probably damaging Het
Nynrin T G 14: 55,863,878 S335A probably benign Het
Olfr1389 A G 11: 49,430,998 N174S probably damaging Het
Olfr600 A T 7: 103,346,795 N44K probably damaging Het
Olfr896-ps1 G T 9: 38,292,117 M57I probably benign Het
Pidd1 A T 7: 141,440,302 D570E probably damaging Het
Ppfia3 T C 7: 45,352,207 D427G possibly damaging Het
Prex1 T C 2: 166,599,655 Y364C probably damaging Het
Prlr A G 15: 10,319,302 S142G probably damaging Het
Rack1 T C 11: 48,803,495 V174A probably damaging Het
Rhbdl3 C T 11: 80,337,496 A264V probably damaging Het
Sh3bp5 T A 14: 31,379,516 M170L probably damaging Het
Skint5 A T 4: 113,942,596 F125L possibly damaging Het
Slc6a4 T C 11: 77,027,168 Y579H probably benign Het
Tmem106b A T 6: 13,081,555 T154S possibly damaging Het
Xrcc5 A G 1: 72,343,030 D455G possibly damaging Het
Other mutations in 4932443I19Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
R4723:4932443I19Rik UTSW 8 13735937 missense probably damaging 0.97
R5741:4932443I19Rik UTSW 8 13734835 missense possibly damaging 0.81
R5921:4932443I19Rik UTSW 8 13734840 missense probably damaging 1.00
R6254:4932443I19Rik UTSW 8 13706043 missense possibly damaging 0.87
R6932:4932443I19Rik UTSW 8 13734865 frame shift probably null
R6933:4932443I19Rik UTSW 8 13734865 frame shift probably null
Predicted Primers PCR Primer
(F):5'- CTCACTTCTGAGGGTTGCTG -3'
(R):5'- AGAACAGGTTCAGTTAGCCCTTTG -3'

Sequencing Primer
(F):5'- CACTTCTGAGGGTTGCTGAAATCC -3'
(R):5'- AGTTAGCCCTTTGGTGACAC -3'
Posted On2018-11-06