Incidental Mutation 'R6935:Lingo1'
ID540254
Institutional Source Beutler Lab
Gene Symbol Lingo1
Ensembl Gene ENSMUSG00000049556
Gene Nameleucine rich repeat and Ig domain containing 1
SynonymsLINGO-1, LERN1, Lrrn6a, UNQ201, 4930471K13Rik
MMRRC Submission
Accession Numbers

Genbank: NM_181074; MGI: 1915522

Is this an essential gene? Probably non essential (E-score: 0.250) question?
Stock #R6935 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location56618475-56796468 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 56619865 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 480 (Y480C)
Ref Sequence ENSEMBL: ENSMUSP00000148179 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053568] [ENSMUST00000114247] [ENSMUST00000114256] [ENSMUST00000210032]
Predicted Effect probably damaging
Transcript: ENSMUST00000053568
AA Change: Y480C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000059050
Gene: ENSMUSG00000049556
AA Change: Y480C

DomainStartEndE-ValueType
low complexity region 21 32 N/A INTRINSIC
LRRNT 35 69 1.6e-3 SMART
LRR 88 111 6.22e0 SMART
LRR_TYP 112 135 5.81e-2 SMART
LRR 136 159 6.57e-1 SMART
LRR 160 183 3.02e0 SMART
LRR 184 207 1.51e0 SMART
LRR 208 231 1.81e2 SMART
LRR 280 303 8.26e1 SMART
LRR 304 327 9.24e1 SMART
LRR 328 351 1.43e-1 SMART
LRRCT 363 416 4.15e-2 SMART
IGc2 431 498 1.58e-10 SMART
transmembrane domain 554 576 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114247
AA Change: Y480C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000109885
Gene: ENSMUSG00000049556
AA Change: Y480C

DomainStartEndE-ValueType
low complexity region 21 32 N/A INTRINSIC
LRRNT 35 69 1.6e-3 SMART
LRR 88 111 6.22e0 SMART
LRR_TYP 112 135 5.81e-2 SMART
LRR 136 159 6.57e-1 SMART
LRR 160 183 3.02e0 SMART
LRR 184 207 1.51e0 SMART
LRR 208 231 1.81e2 SMART
LRR 280 303 8.26e1 SMART
LRR 304 327 9.24e1 SMART
LRR 328 351 1.43e-1 SMART
LRRCT 363 416 4.15e-2 SMART
IGc2 431 498 1.58e-10 SMART
transmembrane domain 554 576 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114256
AA Change: Y486C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000109894
Gene: ENSMUSG00000049556
AA Change: Y486C

DomainStartEndE-ValueType
low complexity region 27 38 N/A INTRINSIC
LRRNT 41 75 1.6e-3 SMART
LRR 94 117 6.22e0 SMART
LRR_TYP 118 141 5.81e-2 SMART
LRR 142 165 6.57e-1 SMART
LRR 166 189 3.02e0 SMART
LRR 190 213 1.51e0 SMART
LRR 214 237 1.81e2 SMART
LRR 286 309 8.26e1 SMART
LRR 310 333 9.24e1 SMART
LRR 334 357 1.43e-1 SMART
LRRCT 369 422 4.15e-2 SMART
IGc2 437 504 1.58e-10 SMART
transmembrane domain 560 582 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000210032
AA Change: Y480C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Meta Mutation Damage Score 0.058 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 97.2%
Validation Efficiency 98% (41/42)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit early-onset CNS myelination. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930596D02Rik T A 14: 35,811,907 H14L probably benign Het
4932443I19Rik CA CAA 8: 13,734,865 probably null Het
Adar A G 3: 89,747,218 N368D probably benign Het
Adcy10 T C 1: 165,506,635 V71A probably benign Het
Ank1 C T 8: 23,108,231 T755I probably damaging Het
Aoc1 A T 6: 48,908,227 Y632F probably damaging Het
Bbc3 A G 7: 16,312,199 D20G possibly damaging Het
Bche T G 3: 73,701,800 I98L probably benign Het
Col12a1 A G 9: 79,700,500 Y349H possibly damaging Het
Crip2 T C 12: 113,140,593 C8R probably damaging Het
Dhx58 T A 11: 100,698,406 probably null Het
Dnah2 G A 11: 69,421,741 R4333C probably damaging Het
Dnajb12 T C 10: 59,896,503 probably null Het
Dzank1 T C 2: 144,476,094 E718G possibly damaging Het
Fbxo28 C T 1: 182,341,460 G38R unknown Het
Foxb2 A G 19: 16,872,619 F341S probably benign Het
Gabrb3 T A 7: 57,591,813 I29N probably damaging Het
Gm4881 C A 7: 24,928,561 G181V possibly damaging Het
Gm7298 G A 6: 121,767,694 R557H probably benign Het
Itih3 T A 14: 30,912,702 Q116L possibly damaging Het
Lypd3 G C 7: 24,638,433 G75R probably damaging Het
Mbd5 A G 2: 49,279,812 Y113C probably damaging Het
Mcm3ap C T 10: 76,504,253 P1453S possibly damaging Het
Mdn1 T G 4: 32,774,041 F5551V possibly damaging Het
Myo16 T A 8: 10,569,820 M1457K probably benign Het
Nbeal2 T A 9: 110,639,391 E372V probably damaging Het
Ncam2 T A 16: 81,526,991 S508T probably benign Het
Nebl A T 2: 17,348,826 D971E probably damaging Het
Nlrp10 A T 7: 108,926,900 M77K probably damaging Het
Nynrin T G 14: 55,863,878 S335A probably benign Het
Olfr1389 A G 11: 49,430,998 N174S probably damaging Het
Olfr600 A T 7: 103,346,795 N44K probably damaging Het
Olfr896-ps1 G T 9: 38,292,117 M57I probably benign Het
Pidd1 A T 7: 141,440,302 D570E probably damaging Het
Ppfia3 T C 7: 45,352,207 D427G possibly damaging Het
Prex1 T C 2: 166,599,655 Y364C probably damaging Het
Prlr A G 15: 10,319,302 S142G probably damaging Het
Rack1 T C 11: 48,803,495 V174A probably damaging Het
Rhbdl3 C T 11: 80,337,496 A264V probably damaging Het
Sh3bp5 T A 14: 31,379,516 M170L probably damaging Het
Skint5 A T 4: 113,942,596 F125L possibly damaging Het
Slc6a4 T C 11: 77,027,168 Y579H probably benign Het
Tmem106b A T 6: 13,081,555 T154S possibly damaging Het
Xrcc5 A G 1: 72,343,030 D455G possibly damaging Het
Other mutations in Lingo1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01648:Lingo1 APN 9 56619827 missense probably damaging 1.00
IGL02335:Lingo1 APN 9 56620081 missense probably damaging 1.00
IGL03093:Lingo1 APN 9 56619464 missense possibly damaging 0.90
3-1:Lingo1 UTSW 9 56620420 missense probably benign 0.02
R1840:Lingo1 UTSW 9 56620558 missense probably benign 0.38
R1932:Lingo1 UTSW 9 56619650 missense possibly damaging 0.89
R2475:Lingo1 UTSW 9 56619626 missense probably benign 0.03
R3439:Lingo1 UTSW 9 56620733 missense probably benign 0.23
R3870:Lingo1 UTSW 9 56619725 missense probably benign 0.00
R4241:Lingo1 UTSW 9 56620102 missense probably damaging 1.00
R4701:Lingo1 UTSW 9 56620258 missense probably damaging 1.00
R4757:Lingo1 UTSW 9 56619925 missense probably benign 0.14
R5451:Lingo1 UTSW 9 56620427 missense probably damaging 1.00
R6190:Lingo1 UTSW 9 56619650 missense possibly damaging 0.89
R6254:Lingo1 UTSW 9 56620087 missense possibly damaging 0.55
R6836:Lingo1 UTSW 9 56619772 missense probably damaging 0.99
R6849:Lingo1 UTSW 9 56619616 missense probably damaging 1.00
R7051:Lingo1 UTSW 9 56620183 missense probably benign 0.35
R7116:Lingo1 UTSW 9 56620627 missense probably benign 0.17
R7196:Lingo1 UTSW 9 56620619 missense probably damaging 1.00
X0023:Lingo1 UTSW 9 56620028 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGCGTCTTGATGTCGAAGGG -3'
(R):5'- CGGATGTACTCCTACCCAAC -3'

Sequencing Primer
(F):5'- CGTCTTGATGTCGAAGGGGAAAG -3'
(R):5'- GGATGTACTCCTACCCAACTACTTC -3'
Posted On2018-11-06