Incidental Mutation 'R6935:Col12a1'
ID 540255
Institutional Source Beutler Lab
Gene Symbol Col12a1
Ensembl Gene ENSMUSG00000032332
Gene Name collagen, type XII, alpha 1
Synonyms
MMRRC Submission 045008-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.845) question?
Stock # R6935 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 79506273-79626113 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 79607782 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 349 (Y349H)
Ref Sequence ENSEMBL: ENSMUSP00000112604 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071750] [ENSMUST00000121227]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000071750
AA Change: Y349H

PolyPhen 2 Score 0.116 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000071662
Gene: ENSMUSG00000032332
AA Change: Y349H

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
FN3 25 103 2.29e-10 SMART
low complexity region 114 129 N/A INTRINSIC
VWA 138 317 4e-63 SMART
FN3 334 413 1.47e-8 SMART
VWA 438 617 2.41e-57 SMART
FN3 632 710 1.62e-10 SMART
FN3 723 801 2.91e-12 SMART
FN3 814 892 6.05e-10 SMART
FN3 905 984 2.74e-8 SMART
FN3 995 1074 1.24e-6 SMART
FN3 1087 1166 5.78e-7 SMART
VWA 1197 1376 2.02e-59 SMART
FN3 1385 1463 1.13e-9 SMART
FN3 1474 1554 1.07e-10 SMART
FN3 1566 1643 3.73e-10 SMART
FN3 1655 1734 2.94e-8 SMART
FN3 1755 1834 1.54e-11 SMART
FN3 1846 1924 1.45e-7 SMART
FN3 1936 2015 1.47e-8 SMART
FN3 2027 2106 1.21e-9 SMART
FN3 2118 2195 2.14e-10 SMART
FN3 2206 2285 3.85e-3 SMART
low complexity region 2292 2314 N/A INTRINSIC
VWA 2323 2503 2.61e-53 SMART
TSPN 2522 2714 1.13e-76 SMART
Pfam:Collagen 2747 2804 1.7e-8 PFAM
Pfam:Collagen 2802 2855 6.5e-9 PFAM
Pfam:Collagen 2844 2904 1.1e-9 PFAM
Pfam:Collagen 2939 2994 4.6e-8 PFAM
low complexity region 3011 3044 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000121227
AA Change: Y349H

PolyPhen 2 Score 0.762 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000112604
Gene: ENSMUSG00000032332
AA Change: Y349H

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
FN3 25 103 2.29e-10 SMART
low complexity region 114 129 N/A INTRINSIC
VWA 138 317 4e-63 SMART
FN3 334 413 1.47e-8 SMART
VWA 438 617 2.41e-57 SMART
FN3 632 710 1.62e-10 SMART
FN3 723 801 2.91e-12 SMART
FN3 814 892 6.05e-10 SMART
FN3 905 984 2.74e-8 SMART
FN3 995 1074 1.24e-6 SMART
FN3 1087 1166 5.78e-7 SMART
VWA 1197 1376 2.02e-59 SMART
FN3 1385 1463 1.13e-9 SMART
FN3 1474 1554 1.07e-10 SMART
FN3 1566 1643 3.73e-10 SMART
FN3 1655 1734 2.94e-8 SMART
FN3 1755 1834 1.54e-11 SMART
FN3 1846 1924 1.45e-7 SMART
FN3 1936 2015 1.47e-8 SMART
FN3 2027 2106 1.21e-9 SMART
FN3 2118 2195 2.14e-10 SMART
FN3 2206 2285 3.85e-3 SMART
low complexity region 2292 2314 N/A INTRINSIC
VWA 2323 2503 2.61e-53 SMART
TSPN 2522 2714 1.13e-76 SMART
Pfam:Collagen 2747 2804 4.7e-9 PFAM
Pfam:Collagen 2802 2861 2.9e-9 PFAM
Pfam:Collagen 2838 2900 7.1e-8 PFAM
Pfam:Collagen 2935 2990 1.3e-8 PFAM
low complexity region 3007 3040 N/A INTRINSIC
Meta Mutation Damage Score 0.3387 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 97.2%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha chain of type XII collagen, a member of the FACIT (fibril-associated collagens with interrupted triple helices) collagen family. Type XII collagen is a homotrimer found in association with type I collagen, an association that is thought to modify the interactions between collagen I fibrils and the surrounding matrix. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit partial perinatal lethality, decreased body weight, shorter and slender long bones, altered vertebrae structure, kyphosis, decreased bone strength, and abnormalities in osteoblast differentiation and bone matrix formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930596D02Rik T A 14: 35,533,864 (GRCm39) H14L probably benign Het
Adar A G 3: 89,654,525 (GRCm39) N368D probably benign Het
Adcy10 T C 1: 165,334,204 (GRCm39) V71A probably benign Het
Ank1 C T 8: 23,598,247 (GRCm39) T755I probably damaging Het
Aoc1 A T 6: 48,885,161 (GRCm39) Y632F probably damaging Het
Bbc3 A G 7: 16,046,124 (GRCm39) D20G possibly damaging Het
Bche T G 3: 73,609,133 (GRCm39) I98L probably benign Het
Cfap97d2 CA CAA 8: 13,784,865 (GRCm39) probably null Het
Crip2 T C 12: 113,104,213 (GRCm39) C8R probably damaging Het
Dhx58 T A 11: 100,589,232 (GRCm39) probably null Het
Dnah2 G A 11: 69,312,567 (GRCm39) R4333C probably damaging Het
Dnajb12 T C 10: 59,732,325 (GRCm39) probably null Het
Dzank1 T C 2: 144,318,014 (GRCm39) E718G possibly damaging Het
Erfl C A 7: 24,627,986 (GRCm39) G181V possibly damaging Het
Fbxo28 C T 1: 182,169,025 (GRCm39) G38R unknown Het
Foxb2 A G 19: 16,849,983 (GRCm39) F341S probably benign Het
Gabrb3 T A 7: 57,241,561 (GRCm39) I29N probably damaging Het
Gm7298 G A 6: 121,744,653 (GRCm39) R557H probably benign Het
Itih3 T A 14: 30,634,659 (GRCm39) Q116L possibly damaging Het
Lingo1 T C 9: 56,527,149 (GRCm39) Y480C probably damaging Het
Lypd3 G C 7: 24,337,858 (GRCm39) G75R probably damaging Het
Mbd5 A G 2: 49,169,824 (GRCm39) Y113C probably damaging Het
Mcm3ap C T 10: 76,340,087 (GRCm39) P1453S possibly damaging Het
Mdn1 T G 4: 32,774,041 (GRCm39) F5551V possibly damaging Het
Myo16 T A 8: 10,619,820 (GRCm39) M1457K probably benign Het
Nbeal2 T A 9: 110,468,459 (GRCm39) E372V probably damaging Het
Ncam2 T A 16: 81,323,879 (GRCm39) S508T probably benign Het
Nebl A T 2: 17,353,637 (GRCm39) D971E probably damaging Het
Nlrp10 A T 7: 108,526,107 (GRCm39) M77K probably damaging Het
Nynrin T G 14: 56,101,335 (GRCm39) S335A probably benign Het
Or2y1d A G 11: 49,321,825 (GRCm39) N174S probably damaging Het
Or52ad1 A T 7: 102,996,002 (GRCm39) N44K probably damaging Het
Or8c18 G T 9: 38,203,413 (GRCm39) M57I probably benign Het
Pidd1 A T 7: 141,020,215 (GRCm39) D570E probably damaging Het
Ppfia3 T C 7: 45,001,631 (GRCm39) D427G possibly damaging Het
Prex1 T C 2: 166,441,575 (GRCm39) Y364C probably damaging Het
Prlr A G 15: 10,319,388 (GRCm39) S142G probably damaging Het
Rack1 T C 11: 48,694,322 (GRCm39) V174A probably damaging Het
Rhbdl3 C T 11: 80,228,322 (GRCm39) A264V probably damaging Het
Sh3bp5 T A 14: 31,101,473 (GRCm39) M170L probably damaging Het
Skint5 A T 4: 113,799,793 (GRCm39) F125L possibly damaging Het
Slc6a4 T C 11: 76,917,994 (GRCm39) Y579H probably benign Het
Tmem106b A T 6: 13,081,554 (GRCm39) T154S possibly damaging Het
Xrcc5 A G 1: 72,382,189 (GRCm39) D455G possibly damaging Het
Other mutations in Col12a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Col12a1 APN 9 79,588,819 (GRCm39) missense possibly damaging 0.55
IGL00434:Col12a1 APN 9 79,560,614 (GRCm39) missense probably benign 0.27
IGL00465:Col12a1 APN 9 79,604,863 (GRCm39) missense probably damaging 1.00
IGL00568:Col12a1 APN 9 79,558,759 (GRCm39) missense probably damaging 1.00
IGL00576:Col12a1 APN 9 79,554,934 (GRCm39) missense probably damaging 1.00
IGL00580:Col12a1 APN 9 79,599,508 (GRCm39) missense probably benign 0.05
IGL01015:Col12a1 APN 9 79,541,023 (GRCm39) missense probably damaging 1.00
IGL01124:Col12a1 APN 9 79,611,129 (GRCm39) missense probably damaging 1.00
IGL01138:Col12a1 APN 9 79,585,335 (GRCm39) missense probably damaging 1.00
IGL01295:Col12a1 APN 9 79,551,208 (GRCm39) missense probably damaging 1.00
IGL01630:Col12a1 APN 9 79,564,648 (GRCm39) missense probably damaging 1.00
IGL01648:Col12a1 APN 9 79,508,451 (GRCm39) makesense probably null
IGL01878:Col12a1 APN 9 79,557,257 (GRCm39) missense possibly damaging 0.72
IGL01921:Col12a1 APN 9 79,557,299 (GRCm39) missense possibly damaging 0.50
IGL02064:Col12a1 APN 9 79,599,654 (GRCm39) missense probably benign 0.06
IGL02123:Col12a1 APN 9 79,569,740 (GRCm39) critical splice donor site probably null
IGL02312:Col12a1 APN 9 79,588,797 (GRCm39) missense probably damaging 1.00
IGL02320:Col12a1 APN 9 79,523,303 (GRCm39) critical splice donor site probably null
IGL02328:Col12a1 APN 9 79,589,348 (GRCm39) missense probably damaging 1.00
IGL02342:Col12a1 APN 9 79,557,178 (GRCm39) splice site probably null
IGL02355:Col12a1 APN 9 79,537,993 (GRCm39) splice site probably benign
IGL02362:Col12a1 APN 9 79,537,993 (GRCm39) splice site probably benign
IGL02396:Col12a1 APN 9 79,569,865 (GRCm39) missense probably benign
IGL02449:Col12a1 APN 9 79,548,751 (GRCm39) missense probably damaging 1.00
IGL02682:Col12a1 APN 9 79,606,623 (GRCm39) missense probably damaging 1.00
IGL02751:Col12a1 APN 9 79,521,141 (GRCm39) unclassified probably benign
IGL02801:Col12a1 APN 9 79,515,696 (GRCm39) splice site probably null
IGL03001:Col12a1 APN 9 79,540,955 (GRCm39) missense probably damaging 1.00
IGL03027:Col12a1 APN 9 79,548,833 (GRCm39) missense probably benign 0.40
IGL03090:Col12a1 APN 9 79,585,652 (GRCm39) missense probably damaging 1.00
IGL03115:Col12a1 APN 9 79,588,719 (GRCm39) missense probably damaging 1.00
IGL03220:Col12a1 APN 9 79,606,765 (GRCm39) missense probably damaging 1.00
IGL03240:Col12a1 APN 9 79,585,665 (GRCm39) splice site probably null
IGL03348:Col12a1 APN 9 79,600,712 (GRCm39) missense possibly damaging 0.88
airship UTSW 9 79,613,619 (GRCm39) missense possibly damaging 0.65
dirigible UTSW 9 79,611,111 (GRCm39) missense possibly damaging 0.73
Feast UTSW 9 79,607,544 (GRCm39) missense probably benign 0.00
hardly UTSW 9 79,607,632 (GRCm39) nonsense probably null
hearty UTSW 9 79,551,248 (GRCm39) missense probably damaging 1.00
Hefty UTSW 9 79,569,736 (GRCm39) splice site probably benign
P0045:Col12a1 UTSW 9 79,554,893 (GRCm39) missense probably damaging 0.99
PIT4260001:Col12a1 UTSW 9 79,558,662 (GRCm39) critical splice donor site probably null
PIT4280001:Col12a1 UTSW 9 79,585,387 (GRCm39) missense probably damaging 1.00
R0015:Col12a1 UTSW 9 79,558,667 (GRCm39) missense probably damaging 1.00
R0015:Col12a1 UTSW 9 79,558,667 (GRCm39) missense probably damaging 1.00
R0240:Col12a1 UTSW 9 79,559,315 (GRCm39) missense probably benign 0.02
R0276:Col12a1 UTSW 9 79,538,023 (GRCm39) nonsense probably null
R0309:Col12a1 UTSW 9 79,507,293 (GRCm39) splice site probably null
R0336:Col12a1 UTSW 9 79,609,627 (GRCm39) missense probably damaging 0.98
R0376:Col12a1 UTSW 9 79,600,776 (GRCm39) missense probably benign 0.10
R0413:Col12a1 UTSW 9 79,606,642 (GRCm39) missense probably damaging 0.99
R0504:Col12a1 UTSW 9 79,588,750 (GRCm39) missense possibly damaging 0.90
R0542:Col12a1 UTSW 9 79,512,610 (GRCm39) critical splice donor site probably null
R0610:Col12a1 UTSW 9 79,615,130 (GRCm39) missense probably benign
R0631:Col12a1 UTSW 9 79,610,658 (GRCm39) missense probably damaging 1.00
R0637:Col12a1 UTSW 9 79,564,017 (GRCm39) missense probably benign 0.00
R0667:Col12a1 UTSW 9 79,535,744 (GRCm39) missense probably damaging 1.00
R0711:Col12a1 UTSW 9 79,559,317 (GRCm39) missense probably damaging 1.00
R0717:Col12a1 UTSW 9 79,519,701 (GRCm39) missense probably damaging 1.00
R0762:Col12a1 UTSW 9 79,588,656 (GRCm39) splice site probably benign
R0787:Col12a1 UTSW 9 79,545,767 (GRCm39) missense probably damaging 0.99
R0890:Col12a1 UTSW 9 79,607,684 (GRCm39) missense probably damaging 0.97
R0900:Col12a1 UTSW 9 79,591,535 (GRCm39) missense possibly damaging 0.91
R1109:Col12a1 UTSW 9 79,607,005 (GRCm39) missense probably damaging 1.00
R1264:Col12a1 UTSW 9 79,527,371 (GRCm39) missense probably benign 0.09
R1321:Col12a1 UTSW 9 79,524,991 (GRCm39) nonsense probably null
R1344:Col12a1 UTSW 9 79,606,837 (GRCm39) nonsense probably null
R1387:Col12a1 UTSW 9 79,588,657 (GRCm39) splice site probably benign
R1511:Col12a1 UTSW 9 79,606,834 (GRCm39) missense probably benign 0.02
R1523:Col12a1 UTSW 9 79,568,278 (GRCm39) missense probably benign 0.01
R1526:Col12a1 UTSW 9 79,564,080 (GRCm39) missense probably benign 0.44
R1564:Col12a1 UTSW 9 79,521,122 (GRCm39) missense probably damaging 1.00
R1595:Col12a1 UTSW 9 79,509,536 (GRCm39) missense probably damaging 1.00
R1603:Col12a1 UTSW 9 79,520,244 (GRCm39) missense probably damaging 1.00
R1673:Col12a1 UTSW 9 79,600,820 (GRCm39) missense probably benign 0.00
R1730:Col12a1 UTSW 9 79,535,660 (GRCm39) missense possibly damaging 0.93
R1737:Col12a1 UTSW 9 79,610,733 (GRCm39) missense probably damaging 1.00
R1739:Col12a1 UTSW 9 79,540,750 (GRCm39) missense probably damaging 0.98
R1748:Col12a1 UTSW 9 79,580,279 (GRCm39) missense probably benign 0.01
R1778:Col12a1 UTSW 9 79,511,867 (GRCm39) splice site probably benign
R1845:Col12a1 UTSW 9 79,604,823 (GRCm39) missense probably benign 0.09
R1864:Col12a1 UTSW 9 79,534,385 (GRCm39) splice site probably null
R1876:Col12a1 UTSW 9 79,585,563 (GRCm39) nonsense probably null
R1934:Col12a1 UTSW 9 79,511,804 (GRCm39) nonsense probably null
R1942:Col12a1 UTSW 9 79,542,748 (GRCm39) missense probably damaging 1.00
R1950:Col12a1 UTSW 9 79,537,831 (GRCm39) missense possibly damaging 0.62
R2027:Col12a1 UTSW 9 79,553,075 (GRCm39) critical splice acceptor site probably null
R2061:Col12a1 UTSW 9 79,524,987 (GRCm39) missense possibly damaging 0.88
R2064:Col12a1 UTSW 9 79,569,736 (GRCm39) splice site probably benign
R2070:Col12a1 UTSW 9 79,554,978 (GRCm39) missense probably benign 0.00
R2112:Col12a1 UTSW 9 79,551,181 (GRCm39) missense possibly damaging 0.93
R2209:Col12a1 UTSW 9 79,599,634 (GRCm39) missense possibly damaging 0.83
R2275:Col12a1 UTSW 9 79,542,709 (GRCm39) missense probably damaging 0.99
R2330:Col12a1 UTSW 9 79,540,939 (GRCm39) missense probably damaging 0.99
R2373:Col12a1 UTSW 9 79,564,095 (GRCm39) missense probably benign 0.03
R2425:Col12a1 UTSW 9 79,585,648 (GRCm39) missense probably damaging 1.00
R2428:Col12a1 UTSW 9 79,509,533 (GRCm39) missense probably benign 0.30
R2437:Col12a1 UTSW 9 79,599,501 (GRCm39) missense probably damaging 0.97
R2831:Col12a1 UTSW 9 79,604,683 (GRCm39) missense probably null 0.99
R2851:Col12a1 UTSW 9 79,585,614 (GRCm39) missense probably damaging 1.00
R2872:Col12a1 UTSW 9 79,606,831 (GRCm39) missense probably damaging 1.00
R2872:Col12a1 UTSW 9 79,606,831 (GRCm39) missense probably damaging 1.00
R2874:Col12a1 UTSW 9 79,606,831 (GRCm39) missense probably damaging 1.00
R2904:Col12a1 UTSW 9 79,559,307 (GRCm39) missense probably damaging 1.00
R2905:Col12a1 UTSW 9 79,559,307 (GRCm39) missense probably damaging 1.00
R2991:Col12a1 UTSW 9 79,607,547 (GRCm39) missense probably damaging 1.00
R3402:Col12a1 UTSW 9 79,551,229 (GRCm39) missense probably damaging 1.00
R3429:Col12a1 UTSW 9 79,587,593 (GRCm39) missense probably benign
R3430:Col12a1 UTSW 9 79,587,593 (GRCm39) missense probably benign
R3547:Col12a1 UTSW 9 79,540,698 (GRCm39) missense probably damaging 1.00
R3789:Col12a1 UTSW 9 79,547,005 (GRCm39) missense possibly damaging 0.96
R4091:Col12a1 UTSW 9 79,609,646 (GRCm39) missense probably damaging 0.99
R4328:Col12a1 UTSW 9 79,607,671 (GRCm39) missense possibly damaging 0.91
R4382:Col12a1 UTSW 9 79,538,023 (GRCm39) nonsense probably null
R4392:Col12a1 UTSW 9 79,569,770 (GRCm39) missense probably damaging 1.00
R4405:Col12a1 UTSW 9 79,547,247 (GRCm39) critical splice donor site probably null
R4465:Col12a1 UTSW 9 79,580,192 (GRCm39) missense possibly damaging 0.62
R4521:Col12a1 UTSW 9 79,540,639 (GRCm39) missense probably benign 0.00
R4612:Col12a1 UTSW 9 79,523,339 (GRCm39) missense probably damaging 0.99
R4613:Col12a1 UTSW 9 79,554,883 (GRCm39) missense probably benign 0.03
R4649:Col12a1 UTSW 9 79,547,076 (GRCm39) missense probably damaging 1.00
R4651:Col12a1 UTSW 9 79,520,228 (GRCm39) missense probably damaging 1.00
R4652:Col12a1 UTSW 9 79,520,228 (GRCm39) missense probably damaging 1.00
R4738:Col12a1 UTSW 9 79,606,564 (GRCm39) missense probably damaging 1.00
R4745:Col12a1 UTSW 9 79,559,368 (GRCm39) splice site probably null
R4761:Col12a1 UTSW 9 79,564,592 (GRCm39) missense probably benign 0.34
R4784:Col12a1 UTSW 9 79,585,776 (GRCm39) missense possibly damaging 0.50
R4785:Col12a1 UTSW 9 79,585,776 (GRCm39) missense possibly damaging 0.50
R4809:Col12a1 UTSW 9 79,600,849 (GRCm39) missense probably benign 0.10
R4821:Col12a1 UTSW 9 79,622,622 (GRCm39) intron probably benign
R4925:Col12a1 UTSW 9 79,582,077 (GRCm39) missense probably damaging 1.00
R4938:Col12a1 UTSW 9 79,607,632 (GRCm39) nonsense probably null
R5034:Col12a1 UTSW 9 79,564,649 (GRCm39) missense probably damaging 1.00
R5133:Col12a1 UTSW 9 79,512,456 (GRCm39) missense probably damaging 0.99
R5138:Col12a1 UTSW 9 79,551,248 (GRCm39) missense probably damaging 1.00
R5145:Col12a1 UTSW 9 79,613,582 (GRCm39) missense probably benign 0.00
R5152:Col12a1 UTSW 9 79,564,030 (GRCm39) missense probably damaging 1.00
R5237:Col12a1 UTSW 9 79,607,544 (GRCm39) missense probably benign 0.00
R5268:Col12a1 UTSW 9 79,585,329 (GRCm39) missense probably damaging 0.99
R5328:Col12a1 UTSW 9 79,527,342 (GRCm39) missense probably damaging 0.96
R5372:Col12a1 UTSW 9 79,585,648 (GRCm39) missense probably damaging 1.00
R5440:Col12a1 UTSW 9 79,521,645 (GRCm39) missense probably benign 0.07
R5496:Col12a1 UTSW 9 79,509,467 (GRCm39) splice site probably benign
R5537:Col12a1 UTSW 9 79,606,872 (GRCm39) missense probably damaging 1.00
R5596:Col12a1 UTSW 9 79,611,041 (GRCm39) missense probably damaging 1.00
R5677:Col12a1 UTSW 9 79,606,603 (GRCm39) missense probably damaging 1.00
R5715:Col12a1 UTSW 9 79,523,347 (GRCm39) nonsense probably null
R5796:Col12a1 UTSW 9 79,611,111 (GRCm39) missense possibly damaging 0.73
R5829:Col12a1 UTSW 9 79,540,955 (GRCm39) missense probably damaging 1.00
R5865:Col12a1 UTSW 9 79,511,760 (GRCm39) missense probably benign 0.00
R5919:Col12a1 UTSW 9 79,509,580 (GRCm39) missense probably damaging 0.99
R5974:Col12a1 UTSW 9 79,589,409 (GRCm39) missense probably damaging 0.99
R5981:Col12a1 UTSW 9 79,585,788 (GRCm39) missense probably damaging 0.99
R5982:Col12a1 UTSW 9 79,537,842 (GRCm39) missense probably damaging 1.00
R6027:Col12a1 UTSW 9 79,563,860 (GRCm39) critical splice donor site probably null
R6090:Col12a1 UTSW 9 79,599,675 (GRCm39) missense probably damaging 1.00
R6293:Col12a1 UTSW 9 79,521,640 (GRCm39) missense probably benign 0.00
R6393:Col12a1 UTSW 9 79,562,767 (GRCm39) missense probably damaging 0.99
R6457:Col12a1 UTSW 9 79,552,973 (GRCm39) missense probably damaging 1.00
R6505:Col12a1 UTSW 9 79,554,887 (GRCm39) missense probably damaging 0.98
R6508:Col12a1 UTSW 9 79,557,231 (GRCm39) missense probably damaging 1.00
R6620:Col12a1 UTSW 9 79,527,331 (GRCm39) missense probably damaging 0.98
R6718:Col12a1 UTSW 9 79,606,887 (GRCm39) missense probably damaging 1.00
R6752:Col12a1 UTSW 9 79,540,706 (GRCm39) missense possibly damaging 0.72
R6774:Col12a1 UTSW 9 79,613,619 (GRCm39) missense possibly damaging 0.65
R6872:Col12a1 UTSW 9 79,584,516 (GRCm39) missense probably damaging 1.00
R6884:Col12a1 UTSW 9 79,547,091 (GRCm39) missense possibly damaging 0.92
R7198:Col12a1 UTSW 9 79,557,314 (GRCm39) missense possibly damaging 0.56
R7296:Col12a1 UTSW 9 79,589,348 (GRCm39) missense probably damaging 1.00
R7365:Col12a1 UTSW 9 79,613,642 (GRCm39) missense probably damaging 0.99
R7466:Col12a1 UTSW 9 79,562,689 (GRCm39) missense possibly damaging 0.95
R7516:Col12a1 UTSW 9 79,520,192 (GRCm39) splice site probably null
R7584:Col12a1 UTSW 9 79,610,578 (GRCm39) critical splice donor site probably null
R7624:Col12a1 UTSW 9 79,553,076 (GRCm39) splice site probably null
R7670:Col12a1 UTSW 9 79,538,925 (GRCm39) missense probably damaging 1.00
R7678:Col12a1 UTSW 9 79,558,768 (GRCm39) missense probably damaging 0.99
R7702:Col12a1 UTSW 9 79,588,803 (GRCm39) missense probably damaging 1.00
R7796:Col12a1 UTSW 9 79,585,833 (GRCm39) missense possibly damaging 0.88
R7902:Col12a1 UTSW 9 79,548,863 (GRCm39) missense probably benign 0.00
R7923:Col12a1 UTSW 9 79,585,775 (GRCm39) missense probably benign 0.00
R7986:Col12a1 UTSW 9 79,511,674 (GRCm39) critical splice donor site probably null
R8004:Col12a1 UTSW 9 79,591,683 (GRCm39) missense probably damaging 1.00
R8046:Col12a1 UTSW 9 79,613,508 (GRCm39) critical splice donor site probably null
R8056:Col12a1 UTSW 9 79,507,220 (GRCm39) missense
R8151:Col12a1 UTSW 9 79,537,831 (GRCm39) missense possibly damaging 0.62
R8203:Col12a1 UTSW 9 79,588,831 (GRCm39) missense possibly damaging 0.94
R8221:Col12a1 UTSW 9 79,551,224 (GRCm39) missense probably damaging 1.00
R8294:Col12a1 UTSW 9 79,606,594 (GRCm39) missense possibly damaging 0.91
R8309:Col12a1 UTSW 9 79,512,465 (GRCm39) missense possibly damaging 0.68
R8319:Col12a1 UTSW 9 79,555,979 (GRCm39) missense probably damaging 0.97
R8351:Col12a1 UTSW 9 79,588,694 (GRCm39) missense probably damaging 0.97
R8442:Col12a1 UTSW 9 79,542,781 (GRCm39) missense probably damaging 1.00
R8500:Col12a1 UTSW 9 79,517,133 (GRCm39) missense probably damaging 1.00
R8682:Col12a1 UTSW 9 79,568,358 (GRCm39) missense probably benign 0.03
R8700:Col12a1 UTSW 9 79,527,371 (GRCm39) missense probably benign 0.09
R8859:Col12a1 UTSW 9 79,587,681 (GRCm39) nonsense probably null
R8898:Col12a1 UTSW 9 79,599,577 (GRCm39) missense probably benign 0.08
R8930:Col12a1 UTSW 9 79,580,665 (GRCm39) missense probably benign
R8932:Col12a1 UTSW 9 79,580,665 (GRCm39) missense probably benign
R8949:Col12a1 UTSW 9 79,581,970 (GRCm39) missense probably benign 0.17
R8962:Col12a1 UTSW 9 79,538,901 (GRCm39) missense probably damaging 1.00
R9045:Col12a1 UTSW 9 79,582,034 (GRCm39) missense probably benign 0.00
R9080:Col12a1 UTSW 9 79,517,133 (GRCm39) missense probably benign 0.06
R9145:Col12a1 UTSW 9 79,527,344 (GRCm39) missense probably benign 0.16
R9163:Col12a1 UTSW 9 79,548,729 (GRCm39) critical splice donor site probably null
R9168:Col12a1 UTSW 9 79,548,783 (GRCm39) nonsense probably null
R9188:Col12a1 UTSW 9 79,509,614 (GRCm39) missense probably benign 0.22
R9258:Col12a1 UTSW 9 79,613,645 (GRCm39) missense probably benign 0.04
R9292:Col12a1 UTSW 9 79,585,805 (GRCm39) missense probably benign 0.33
R9345:Col12a1 UTSW 9 79,541,017 (GRCm39) missense probably benign 0.08
R9382:Col12a1 UTSW 9 79,589,364 (GRCm39) missense probably benign 0.23
R9427:Col12a1 UTSW 9 79,589,445 (GRCm39) missense probably benign 0.15
R9601:Col12a1 UTSW 9 79,525,034 (GRCm39) missense probably damaging 0.98
R9653:Col12a1 UTSW 9 79,584,556 (GRCm39) missense probably benign
R9668:Col12a1 UTSW 9 79,546,960 (GRCm39) nonsense probably null
R9762:Col12a1 UTSW 9 79,527,266 (GRCm39) missense possibly damaging 0.82
X0021:Col12a1 UTSW 9 79,515,767 (GRCm39) missense probably damaging 1.00
X0058:Col12a1 UTSW 9 79,509,506 (GRCm39) missense possibly damaging 0.66
X0061:Col12a1 UTSW 9 79,519,674 (GRCm39) splice site probably null
Z1177:Col12a1 UTSW 9 79,507,268 (GRCm39) missense possibly damaging 0.80
Z1177:Col12a1 UTSW 9 79,546,978 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- TCCATGACCGAAGTGGGTTC -3'
(R):5'- CACTAGGACTCATACAGATGGAAG -3'

Sequencing Primer
(F):5'- ACGTCAGGCCCTTCATGG -3'
(R):5'- GGGTATCAGCCAACACTTTTTG -3'
Posted On 2018-11-06