Incidental Mutation 'R6935:Slc6a4'
ID540262
Institutional Source Beutler Lab
Gene Symbol Slc6a4
Ensembl Gene ENSMUSG00000020838
Gene Namesolute carrier family 6 (neurotransmitter transporter, serotonin), member 4
Synonyms5-HTT, Sert, Htt
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.278) question?
Stock #R6935 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location76998603-77032340 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 77027168 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 579 (Y579H)
Ref Sequence ENSEMBL: ENSMUSP00000104039 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021195] [ENSMUST00000108402]
Predicted Effect probably benign
Transcript: ENSMUST00000021195
AA Change: Y579H

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000021195
Gene: ENSMUSG00000020838
AA Change: Y579H

DomainStartEndE-ValueType
Pfam:5HT_transport_N 24 64 3e-27 PFAM
Pfam:SNF 79 600 7.3e-232 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108402
AA Change: Y579H

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000104039
Gene: ENSMUSG00000020838
AA Change: Y579H

DomainStartEndE-ValueType
Pfam:5HT_transporter 23 64 7.8e-30 PFAM
Pfam:SNF 79 600 7.3e-232 PFAM
Meta Mutation Damage Score 0.146 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 97.2%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integral membrane protein that transports the neurotransmitter serotonin from synaptic spaces into presynaptic neurons. The encoded protein terminates the action of serotonin and recycles it in a sodium-dependent manner. This protein is a target of psychomotor stimulants, such as amphetamines and cocaine, and is a member of the sodium:neurotransmitter symporter family. A repeat length polymorphism in the promoter of this gene has been shown to affect the rate of serotonin uptake and may play a role in sudden infant death syndrome, aggressive behavior in Alzheimer disease patients, and depression-susceptibility in people experiencing emotional trauma. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit greatly diminished brain serotonin levels and lack cortical barrel patterns. Also, mutants lack the locomotor enhancing response to the drug (+)-3,4-methylenedioxymethamphetamine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930596D02Rik T A 14: 35,811,907 H14L probably benign Het
4932443I19Rik CA CAA 8: 13,734,865 probably null Het
Adar A G 3: 89,747,218 N368D probably benign Het
Adcy10 T C 1: 165,506,635 V71A probably benign Het
Ank1 C T 8: 23,108,231 T755I probably damaging Het
Aoc1 A T 6: 48,908,227 Y632F probably damaging Het
Bbc3 A G 7: 16,312,199 D20G possibly damaging Het
Bche T G 3: 73,701,800 I98L probably benign Het
Col12a1 A G 9: 79,700,500 Y349H possibly damaging Het
Crip2 T C 12: 113,140,593 C8R probably damaging Het
Dhx58 T A 11: 100,698,406 probably null Het
Dnah2 G A 11: 69,421,741 R4333C probably damaging Het
Dnajb12 T C 10: 59,896,503 probably null Het
Dzank1 T C 2: 144,476,094 E718G possibly damaging Het
Fbxo28 C T 1: 182,341,460 G38R unknown Het
Foxb2 A G 19: 16,872,619 F341S probably benign Het
Gabrb3 T A 7: 57,591,813 I29N probably damaging Het
Gm4881 C A 7: 24,928,561 G181V possibly damaging Het
Gm7298 G A 6: 121,767,694 R557H probably benign Het
Itih3 T A 14: 30,912,702 Q116L possibly damaging Het
Lingo1 T C 9: 56,619,865 Y480C probably damaging Het
Lypd3 G C 7: 24,638,433 G75R probably damaging Het
Mbd5 A G 2: 49,279,812 Y113C probably damaging Het
Mcm3ap C T 10: 76,504,253 P1453S possibly damaging Het
Mdn1 T G 4: 32,774,041 F5551V possibly damaging Het
Myo16 T A 8: 10,569,820 M1457K probably benign Het
Nbeal2 T A 9: 110,639,391 E372V probably damaging Het
Ncam2 T A 16: 81,526,991 S508T probably benign Het
Nebl A T 2: 17,348,826 D971E probably damaging Het
Nlrp10 A T 7: 108,926,900 M77K probably damaging Het
Nynrin T G 14: 55,863,878 S335A probably benign Het
Olfr1389 A G 11: 49,430,998 N174S probably damaging Het
Olfr600 A T 7: 103,346,795 N44K probably damaging Het
Olfr896-ps1 G T 9: 38,292,117 M57I probably benign Het
Pidd1 A T 7: 141,440,302 D570E probably damaging Het
Ppfia3 T C 7: 45,352,207 D427G possibly damaging Het
Prex1 T C 2: 166,599,655 Y364C probably damaging Het
Prlr A G 15: 10,319,302 S142G probably damaging Het
Rack1 T C 11: 48,803,495 V174A probably damaging Het
Rhbdl3 C T 11: 80,337,496 A264V probably damaging Het
Sh3bp5 T A 14: 31,379,516 M170L probably damaging Het
Skint5 A T 4: 113,942,596 F125L possibly damaging Het
Tmem106b A T 6: 13,081,555 T154S possibly damaging Het
Xrcc5 A G 1: 72,343,030 D455G possibly damaging Het
Other mutations in Slc6a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00900:Slc6a4 APN 11 77023180 missense probably benign 0.00
IGL01403:Slc6a4 APN 11 77031672 missense probably benign 0.00
IGL01608:Slc6a4 APN 11 77027135 missense probably damaging 1.00
IGL01759:Slc6a4 APN 11 77013288 missense probably damaging 1.00
IGL02239:Slc6a4 APN 11 77027156 missense probably benign 0.01
IGL02491:Slc6a4 APN 11 77027208 missense probably damaging 1.00
IGL03221:Slc6a4 APN 11 77027105 missense probably benign
R1122:Slc6a4 UTSW 11 77027186 missense possibly damaging 0.90
R1574:Slc6a4 UTSW 11 77019196 missense possibly damaging 0.93
R1574:Slc6a4 UTSW 11 77019196 missense possibly damaging 0.93
R1768:Slc6a4 UTSW 11 77013252 missense probably damaging 1.00
R1876:Slc6a4 UTSW 11 77015164 missense probably benign 0.34
R1884:Slc6a4 UTSW 11 77013375 missense probably benign 0.01
R4362:Slc6a4 UTSW 11 77017078 missense probably damaging 1.00
R4595:Slc6a4 UTSW 11 77019863 missense probably benign 0.16
R4855:Slc6a4 UTSW 11 77013309 missense probably damaging 1.00
R5569:Slc6a4 UTSW 11 77023255 missense possibly damaging 0.88
R5747:Slc6a4 UTSW 11 77010511 missense probably damaging 0.97
R5802:Slc6a4 UTSW 11 77019236 missense probably damaging 1.00
R6242:Slc6a4 UTSW 11 77018358 nonsense probably null
R6344:Slc6a4 UTSW 11 77018254 missense probably damaging 1.00
R6443:Slc6a4 UTSW 11 77023201 missense probably benign 0.05
R7283:Slc6a4 UTSW 11 77010696 missense probably benign
R7313:Slc6a4 UTSW 11 77010701 missense possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- TGTGGCACAAGAGTTCTTTCG -3'
(R):5'- TCATCTTCAGTGAGGTACGTAAAAC -3'

Sequencing Primer
(F):5'- GAGTTCTTTCGAGAATAAACCCC -3'
(R):5'- AATATGTAAGTAGAGCCTTATGGTGG -3'
Posted On2018-11-06