Incidental Mutation 'R6937:Rftn2'
ID540325
Institutional Source Beutler Lab
Gene Symbol Rftn2
Ensembl Gene ENSMUSG00000025978
Gene Nameraftlin family member 2
Synonyms3222401M22Rik, 2700010E02Rik
MMRRC Submission
Accession Numbers

Genbank: NM_028713.1; Ensembl: ENSMUST00000027121, ENSMUST00000114428

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6937 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location55170159-55226782 bp(-) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) T to C at 55194349 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000027121 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027121] [ENSMUST00000027121] [ENSMUST00000132055]
Predicted Effect probably null
Transcript: ENSMUST00000027121
SMART Domains Protein: ENSMUSP00000027121
Gene: ENSMUSG00000025978

DomainStartEndE-ValueType
Pfam:Raftlin 1 439 2e-180 PFAM
low complexity region 467 478 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000027121
SMART Domains Protein: ENSMUSP00000027121
Gene: ENSMUSG00000025978

DomainStartEndE-ValueType
Pfam:Raftlin 1 439 2e-180 PFAM
low complexity region 467 478 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132055
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 97.1%
Validation Efficiency 98% (42/43)
Allele List at MGI

All alleles(12) : Targeted, other(2) Gene trapped(10)

Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd52 T C 10: 128,387,020 V613A probably benign Het
Cdh23 A T 10: 60,487,114 L337Q probably damaging Het
Chrna6 A G 8: 27,407,027 L274P probably damaging Het
Ciita G A 16: 10,512,491 probably null Het
Csnka2ip A T 16: 64,478,695 probably benign Het
Ddx60 G A 8: 62,037,069 D1691N probably damaging Het
Dnah7b T C 1: 46,195,120 I1441T probably damaging Het
Dock4 T C 12: 40,834,635 S1713P probably benign Het
Ep400 T C 5: 110,711,152 probably benign Het
Epn1 T C 7: 5,089,944 I85T probably damaging Het
Eri2 T C 7: 119,786,789 K228E probably damaging Het
Garem1 C T 18: 21,147,770 A510T probably benign Het
Gfm2 T A 13: 97,163,064 probably null Het
Gm37596 T C 3: 93,692,216 N282S probably benign Het
Gm4858 A G 3: 93,074,110 H145R probably benign Het
Hnrnpd T C 5: 99,963,770 T321A probably benign Het
Htr2a A T 14: 74,645,164 I197F probably damaging Het
Krtap2-4 T A 11: 99,614,473 probably benign Het
Lcn3 C A 2: 25,767,811 Y179* probably null Het
Mak A T 13: 41,048,102 M261K probably damaging Het
March7 A G 2: 60,240,966 T605A probably damaging Het
Mcm4 A C 16: 15,636,335 F83V probably benign Het
Myo18b T C 5: 112,802,392 N1546S probably benign Het
Nckap1 T A 2: 80,508,716 K989N probably damaging Het
Ndufaf5 A G 2: 140,181,602 D119G probably damaging Het
Olfr846 A T 9: 19,360,689 V222D probably damaging Het
Pcdh1 T C 18: 38,203,475 T36A possibly damaging Het
Pitpna C T 11: 75,603,731 T100I possibly damaging Het
Pmf1 A T 3: 88,399,189 L102Q probably damaging Het
Robo3 A G 9: 37,429,880 L10P probably benign Het
Serpinb6a T C 13: 33,918,818 I241V possibly damaging Het
St14 A T 9: 31,129,660 probably null Het
Stat6 T C 10: 127,658,702 probably null Het
Tenm4 G A 7: 96,553,496 R106H probably benign Het
Tgfbrap1 A T 1: 43,051,904 V687E probably damaging Het
Trim30d A T 7: 104,483,427 S68T probably damaging Het
Ttn A G 2: 76,832,909 probably benign Het
Ugt3a1 A T 15: 9,292,072 D97V probably benign Het
Ugt8a G A 3: 125,915,601 probably benign Het
Vmn1r184 A T 7: 26,267,325 K165N probably benign Het
Vmn2r86 T A 10: 130,448,654 I523F probably damaging Het
Wapl G A 14: 34,722,354 V588I probably benign Het
Wdr7 C T 18: 63,791,867 P974S probably benign Het
Zfp975 T C 7: 42,665,056 D31G possibly damaging Het
Other mutations in Rftn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00565:Rftn2 APN 1 55204285 missense probably damaging 1.00
IGL01691:Rftn2 APN 1 55214286 missense probably damaging 1.00
IGL02412:Rftn2 APN 1 55206338 missense probably benign 0.01
IGL02458:Rftn2 APN 1 55211192 nonsense probably null
1mM(1):Rftn2 UTSW 1 55206595 missense possibly damaging 0.94
R0446:Rftn2 UTSW 1 55214195 missense probably damaging 0.99
R1167:Rftn2 UTSW 1 55204299 missense probably damaging 1.00
R1172:Rftn2 UTSW 1 55211217 missense probably damaging 0.99
R4171:Rftn2 UTSW 1 55214270 missense probably damaging 1.00
R4350:Rftn2 UTSW 1 55194281 missense probably damaging 1.00
R4487:Rftn2 UTSW 1 55202152 missense possibly damaging 0.74
R4833:Rftn2 UTSW 1 55214240 missense possibly damaging 0.56
R4863:Rftn2 UTSW 1 55172039 missense probably benign 0.01
R5719:Rftn2 UTSW 1 55214286 missense probably damaging 1.00
R6801:Rftn2 UTSW 1 55194259 missense possibly damaging 0.91
R6939:Rftn2 UTSW 1 55194349 critical splice acceptor site probably null
R7344:Rftn2 UTSW 1 55226152 nonsense probably null
R7401:Rftn2 UTSW 1 55194242 critical splice donor site probably null
X0022:Rftn2 UTSW 1 55214136 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TCGTAGGCTTAAGTCAGCATTGG -3'
(R):5'- AATGGCCACTGTCCACTCAC -3'

Sequencing Primer
(F):5'- AGTCAGCATTGGTTAATTTACTCAC -3'
(R):5'- GTCCACTCACTTGGTTTTAAGAAGGC -3'
Posted On2018-11-06