Incidental Mutation 'R6939:2810403A07Rik'
ID540414
Institutional Source Beutler Lab
Gene Symbol 2810403A07Rik
Ensembl Gene ENSMUSG00000028060
Gene NameRIKEN cDNA 2810403A07 gene
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.372) question?
Stock #R6939 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location88685803-88712924 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 88686517 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 71 (M71K)
Ref Sequence ENSEMBL: ENSMUSP00000142760 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029696] [ENSMUST00000198042] [ENSMUST00000198078] [ENSMUST00000199684]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029696
AA Change: M71K

PolyPhen 2 Score 0.794 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000029696
Gene: ENSMUSG00000028060
AA Change: M71K

DomainStartEndE-ValueType
low complexity region 21 66 N/A INTRINSIC
Blast:KH 103 185 2e-28 BLAST
PDB:2YQR|A 229 340 6e-76 PDB
Blast:KH 233 319 1e-36 BLAST
SCOP:d1k1ga_ 233 327 4e-16 SMART
low complexity region 344 384 N/A INTRINSIC
low complexity region 425 436 N/A INTRINSIC
low complexity region 442 458 N/A INTRINSIC
low complexity region 499 510 N/A INTRINSIC
low complexity region 566 579 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000198042
AA Change: M71K

PolyPhen 2 Score 0.614 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000142773
Gene: ENSMUSG00000028060
AA Change: M71K

DomainStartEndE-ValueType
low complexity region 21 66 N/A INTRINSIC
Blast:KH 103 185 7e-29 BLAST
PDB:2YQR|A 229 340 2e-77 PDB
Blast:KH 233 319 2e-37 BLAST
SCOP:d1k1ga_ 233 327 3e-16 SMART
low complexity region 344 384 N/A INTRINSIC
low complexity region 425 436 N/A INTRINSIC
low complexity region 442 458 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000198078
AA Change: M71K

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000142760
Gene: ENSMUSG00000028060
AA Change: M71K

DomainStartEndE-ValueType
low complexity region 21 66 N/A INTRINSIC
Blast:KH 103 185 5e-29 BLAST
PDB:2YQR|A 229 340 1e-77 PDB
Blast:KH 233 319 3e-37 BLAST
SCOP:d1k1ga_ 233 327 4e-17 SMART
low complexity region 410 421 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198351
Predicted Effect possibly damaging
Transcript: ENSMUST00000199684
AA Change: M71K

PolyPhen 2 Score 0.614 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000142353
Gene: ENSMUSG00000028060
AA Change: M71K

DomainStartEndE-ValueType
low complexity region 21 66 N/A INTRINSIC
Blast:KH 103 185 7e-29 BLAST
PDB:2YQR|A 229 340 2e-77 PDB
Blast:KH 233 319 2e-37 BLAST
SCOP:d1k1ga_ 233 327 3e-16 SMART
low complexity region 344 384 N/A INTRINSIC
low complexity region 425 436 N/A INTRINSIC
low complexity region 442 458 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200364
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200588
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.9%
Validation Efficiency 99% (66/67)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T A 13: 59,742,058 K231N possibly damaging Het
A1bg G A 15: 60,920,395 P128L probably damaging Het
Acsm3 T C 7: 119,778,455 V401A probably damaging Het
Arhgef11 C A 3: 87,686,920 N93K probably damaging Het
C1ra G A 6: 124,512,801 probably null Het
Camk2a A G 18: 60,958,154 E236G probably damaging Het
Casc1 A G 6: 145,175,219 F625L possibly damaging Het
Cav2 C A 6: 17,281,411 D17E possibly damaging Het
Ccdc149 T C 5: 52,376,265 S520G probably benign Het
Chd4 C A 6: 125,106,538 H674Q probably damaging Het
Clrn2 A T 5: 45,453,754 probably benign Het
Cntnap1 A C 11: 101,186,511 I1000L probably damaging Het
Cyp2c67 T C 19: 39,643,334 T140A possibly damaging Het
D7Ertd443e T C 7: 134,364,479 probably null Het
Dcdc2c G T 12: 28,541,497 Q131K probably benign Het
Dmpk T A 7: 19,088,224 V369E probably damaging Het
Dnah11 A T 12: 118,106,562 W1503R probably damaging Het
Dok2 T C 14: 70,775,605 V71A probably benign Het
Dqx1 A T 6: 83,059,465 Q150L probably damaging Het
Extl3 A G 14: 65,066,740 I740T possibly damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fat2 C T 11: 55,252,474 W4183* probably null Het
Fkrp C T 7: 16,811,826 R37Q probably benign Het
Frem3 A G 8: 80,615,145 K1356E probably benign Het
Fus A T 7: 127,972,569 probably benign Het
Gabarapl2 C A 8: 111,942,569 S53* probably null Het
Gjc1 A C 11: 102,800,907 M90R probably damaging Het
Gm30083 C T 14: 34,003,600 probably null Het
Gm7356 T A 17: 14,001,125 Y214F probably benign Het
Hexdc A T 11: 121,222,338 D533V probably benign Het
Ift172 G A 5: 31,257,586 A1364V probably damaging Het
Ighmbp2 A T 19: 3,276,907 F186Y probably damaging Het
Inpp5e C A 2: 26,407,762 probably null Het
Iqcb1 A G 16: 36,839,912 T146A possibly damaging Het
Kcnmb2 A G 3: 32,198,316 Y222C probably damaging Het
Kdm6b A G 11: 69,406,762 W284R probably damaging Het
Ksr2 T A 5: 117,765,561 *952R probably null Het
Ldlrap1 C A 4: 134,767,974 probably benign Het
Mpdu1 G A 11: 69,658,055 probably benign Het
Mrgprh A T 17: 12,876,935 T21S probably benign Het
Muc16 T A 9: 18,638,537 T5487S probably benign Het
Mydgf A G 17: 56,183,737 probably null Het
Napa T C 7: 16,115,257 C241R possibly damaging Het
Olfr181 A T 16: 58,926,285 Y95* probably null Het
Olfr479 C A 7: 108,055,105 A41E possibly damaging Het
Olfr964-ps1 T C 9: 39,686,891 T18A possibly damaging Het
Pla2g4f A T 2: 120,307,301 L326Q probably damaging Het
Pramef25 T C 4: 143,948,796 T487A probably benign Het
Psme4 T A 11: 30,837,291 Y1029N probably damaging Het
Ptprj T C 2: 90,459,514 T707A possibly damaging Het
Raet1e T A 10: 22,174,357 M13K possibly damaging Het
Rftn2 T C 1: 55,194,349 probably null Het
Rmi1 A G 13: 58,409,355 I473V probably benign Het
Rps6ka4 A G 19: 6,838,069 F186L probably damaging Het
Ryr1 T A 7: 29,052,326 M3672L possibly damaging Het
Smarca5 A T 8: 80,705,320 C890S possibly damaging Het
Tdrd12 C T 7: 35,485,599 probably null Het
Tecta T C 9: 42,347,997 N1530S probably damaging Het
Tenm4 G A 7: 96,553,496 R106H probably benign Het
Tmem94 A G 11: 115,785,830 S54G possibly damaging Het
Tnk2 T C 16: 32,663,878 V41A probably damaging Het
Trpm1 A G 7: 64,268,297 T462A probably benign Het
Tsg101 T C 7: 46,907,099 T61A probably benign Het
Usp42 T C 5: 143,727,969 N17D probably damaging Het
Zfp607a T A 7: 27,879,048 C514* probably null Het
Zfp866 G T 8: 69,766,221 Q250K probably damaging Het
Other mutations in 2810403A07Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0085:2810403A07Rik UTSW 3 88711739 missense probably damaging 0.99
R0271:2810403A07Rik UTSW 3 88686329 splice site probably benign
R1160:2810403A07Rik UTSW 3 88708862 missense probably damaging 0.99
R2348:2810403A07Rik UTSW 3 88708876 missense probably benign 0.01
R3121:2810403A07Rik UTSW 3 88689292 missense probably damaging 1.00
R3546:2810403A07Rik UTSW 3 88693136 splice site probably benign
R3548:2810403A07Rik UTSW 3 88693136 splice site probably benign
R4688:2810403A07Rik UTSW 3 88686517 missense probably damaging 1.00
R5249:2810403A07Rik UTSW 3 88696725 missense probably damaging 1.00
R5393:2810403A07Rik UTSW 3 88696606 missense probably benign 0.08
R5558:2810403A07Rik UTSW 3 88693096 missense probably damaging 0.98
R5579:2810403A07Rik UTSW 3 88700275 missense probably benign
R5782:2810403A07Rik UTSW 3 88711678 missense probably damaging 0.96
R5809:2810403A07Rik UTSW 3 88708885 missense probably damaging 0.96
R6415:2810403A07Rik UTSW 3 88699972 missense probably benign 0.25
R6566:2810403A07Rik UTSW 3 88711654 missense probably damaging 0.99
R6765:2810403A07Rik UTSW 3 88686429 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTACACAAAGGAAGGCCGTG -3'
(R):5'- ATACTCCCAAACGTGATCTTCACTC -3'

Sequencing Primer
(F):5'- TGGGCCTCAGGATTTCCC -3'
(R):5'- AACGTGATCTTCACTCTAACCGG -3'
Posted On2018-11-06