Incidental Mutation 'R6939:Muc16'
ID540444
Institutional Source Beutler Lab
Gene Symbol Muc16
Ensembl Gene ENSMUSG00000109564
Gene Namemucin 16
Synonyms1110008I14Rik, LOC385009
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.164) question?
Stock #R6939 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location18495455-18674530 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 18638537 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 5487 (T5487S)
Ref Sequence ENSEMBL: ENSMUSP00000147104 (fasta)
Predicted Effect probably benign
Transcript: ENSMUST00000208663
AA Change: T5487S

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.9%
Validation Efficiency 99% (66/67)
MGI Phenotype PHENOTYPE: Homozygous null mice are viable and fertile with no gross histological abnormalities. Homozygous male mice father larger litters when crossed to wild-type females. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T A 13: 59,742,058 K231N possibly damaging Het
2810403A07Rik T A 3: 88,686,517 M71K probably damaging Het
A1bg G A 15: 60,920,395 P128L probably damaging Het
Acsm3 T C 7: 119,778,455 V401A probably damaging Het
Arhgef11 C A 3: 87,686,920 N93K probably damaging Het
C1ra G A 6: 124,512,801 probably null Het
Camk2a A G 18: 60,958,154 E236G probably damaging Het
Casc1 A G 6: 145,175,219 F625L possibly damaging Het
Cav2 C A 6: 17,281,411 D17E possibly damaging Het
Ccdc149 T C 5: 52,376,265 S520G probably benign Het
Chd4 C A 6: 125,106,538 H674Q probably damaging Het
Clrn2 A T 5: 45,453,754 probably benign Het
Cntnap1 A C 11: 101,186,511 I1000L probably damaging Het
Cyp2c67 T C 19: 39,643,334 T140A possibly damaging Het
D7Ertd443e T C 7: 134,364,479 probably null Het
Dcdc2c G T 12: 28,541,497 Q131K probably benign Het
Dmpk T A 7: 19,088,224 V369E probably damaging Het
Dnah11 A T 12: 118,106,562 W1503R probably damaging Het
Dok2 T C 14: 70,775,605 V71A probably benign Het
Dqx1 A T 6: 83,059,465 Q150L probably damaging Het
Extl3 A G 14: 65,066,740 I740T possibly damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fat2 C T 11: 55,252,474 W4183* probably null Het
Fkrp C T 7: 16,811,826 R37Q probably benign Het
Frem3 A G 8: 80,615,145 K1356E probably benign Het
Fus A T 7: 127,972,569 probably benign Het
Gabarapl2 C A 8: 111,942,569 S53* probably null Het
Gjc1 A C 11: 102,800,907 M90R probably damaging Het
Gm30083 C T 14: 34,003,600 probably null Het
Gm7356 T A 17: 14,001,125 Y214F probably benign Het
Hexdc A T 11: 121,222,338 D533V probably benign Het
Ift172 G A 5: 31,257,586 A1364V probably damaging Het
Ighmbp2 A T 19: 3,276,907 F186Y probably damaging Het
Inpp5e C A 2: 26,407,762 probably null Het
Iqcb1 A G 16: 36,839,912 T146A possibly damaging Het
Kcnmb2 A G 3: 32,198,316 Y222C probably damaging Het
Kdm6b A G 11: 69,406,762 W284R probably damaging Het
Ksr2 T A 5: 117,765,561 *952R probably null Het
Ldlrap1 C A 4: 134,767,974 probably benign Het
Mpdu1 G A 11: 69,658,055 probably benign Het
Mrgprh A T 17: 12,876,935 T21S probably benign Het
Mydgf A G 17: 56,183,737 probably null Het
Napa T C 7: 16,115,257 C241R possibly damaging Het
Olfr181 A T 16: 58,926,285 Y95* probably null Het
Olfr479 C A 7: 108,055,105 A41E possibly damaging Het
Olfr964-ps1 T C 9: 39,686,891 T18A possibly damaging Het
Pla2g4f A T 2: 120,307,301 L326Q probably damaging Het
Pramef25 T C 4: 143,948,796 T487A probably benign Het
Psme4 T A 11: 30,837,291 Y1029N probably damaging Het
Ptprj T C 2: 90,459,514 T707A possibly damaging Het
Raet1e T A 10: 22,174,357 M13K possibly damaging Het
Rftn2 T C 1: 55,194,349 probably null Het
Rmi1 A G 13: 58,409,355 I473V probably benign Het
Rps6ka4 A G 19: 6,838,069 F186L probably damaging Het
Ryr1 T A 7: 29,052,326 M3672L possibly damaging Het
Smarca5 A T 8: 80,705,320 C890S possibly damaging Het
Tdrd12 C T 7: 35,485,599 probably null Het
Tecta T C 9: 42,347,997 N1530S probably damaging Het
Tenm4 G A 7: 96,553,496 R106H probably benign Het
Tmem94 A G 11: 115,785,830 S54G possibly damaging Het
Tnk2 T C 16: 32,663,878 V41A probably damaging Het
Trpm1 A G 7: 64,268,297 T462A probably benign Het
Tsg101 T C 7: 46,907,099 T61A probably benign Het
Usp42 T C 5: 143,727,969 N17D probably damaging Het
Zfp607a T A 7: 27,879,048 C514* probably null Het
Zfp866 G T 8: 69,766,221 Q250K probably damaging Het
Other mutations in Muc16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01330:Muc16 APN 9 18508507 missense possibly damaging 0.89
IGL01878:Muc16 APN 9 18495543 missense possibly damaging 0.90
IGL02394:Muc16 APN 9 18498700 missense probably damaging 0.99
IGL02553:Muc16 APN 9 18498553 critical splice donor site probably null
R0400:Muc16 UTSW 9 18510534 missense possibly damaging 0.74
R1620:Muc16 UTSW 9 18510477 missense possibly damaging 0.89
R1695:Muc16 UTSW 9 18497433 missense probably damaging 1.00
R3196:Muc16 UTSW 9 18497830 missense probably damaging 1.00
R5982:Muc16 UTSW 9 18647146 missense unknown
R5990:Muc16 UTSW 9 18659243 missense unknown
R6024:Muc16 UTSW 9 18646671 missense unknown
R6026:Muc16 UTSW 9 18659858 missense unknown
R6028:Muc16 UTSW 9 18657176 missense unknown
R6083:Muc16 UTSW 9 18657212 missense unknown
R6089:Muc16 UTSW 9 18643252 missense unknown
R6109:Muc16 UTSW 9 18655359 missense unknown
R6127:Muc16 UTSW 9 18657878 missense unknown
R6130:Muc16 UTSW 9 18590698 missense probably damaging 1.00
R6146:Muc16 UTSW 9 18497797 missense probably damaging 0.98
R6161:Muc16 UTSW 9 18647818 missense unknown
R6164:Muc16 UTSW 9 18558379 missense probably damaging 1.00
R6185:Muc16 UTSW 9 18654473 missense unknown
R6192:Muc16 UTSW 9 18658689 missense unknown
R6217:Muc16 UTSW 9 18655446 missense unknown
R6232:Muc16 UTSW 9 18656998 missense unknown
R6246:Muc16 UTSW 9 18577067 intron probably null
R6255:Muc16 UTSW 9 18655599 missense unknown
R6280:Muc16 UTSW 9 18579317 critical splice donor site probably null
R6286:Muc16 UTSW 9 18644389 missense unknown
R6287:Muc16 UTSW 9 18659034 missense unknown
R6307:Muc16 UTSW 9 18647588 missense unknown
R6310:Muc16 UTSW 9 18641950 missense probably benign 0.00
R6316:Muc16 UTSW 9 18641819 missense probably benign 0.01
R6335:Muc16 UTSW 9 18660708 missense unknown
R6345:Muc16 UTSW 9 18654926 missense unknown
R6349:Muc16 UTSW 9 18657329 missense unknown
R6366:Muc16 UTSW 9 18646044 missense unknown
R6393:Muc16 UTSW 9 18647399 nonsense probably null
R6440:Muc16 UTSW 9 18641359 missense probably benign 0.01
R6458:Muc16 UTSW 9 18641721 missense probably benign 0.01
R6460:Muc16 UTSW 9 18640516 missense probably benign 0.01
R6481:Muc16 UTSW 9 18550677 critical splice donor site probably null
R6539:Muc16 UTSW 9 18637325 missense probably benign 0.25
R6551:Muc16 UTSW 9 18562562 missense possibly damaging 0.95
R6596:Muc16 UTSW 9 18566715 missense probably benign 0.18
R6601:Muc16 UTSW 9 18637570 missense probably benign 0.10
R6602:Muc16 UTSW 9 18609476 intron probably null
R6615:Muc16 UTSW 9 18647188 missense unknown
R6625:Muc16 UTSW 9 18660278 missense unknown
R6668:Muc16 UTSW 9 18640385 missense probably benign 0.03
R6697:Muc16 UTSW 9 18641291 missense probably benign 0.01
R6710:Muc16 UTSW 9 18642070 missense possibly damaging 0.95
R6727:Muc16 UTSW 9 18566690 critical splice donor site probably null
R6789:Muc16 UTSW 9 18559986 missense probably benign 0.40
R6806:Muc16 UTSW 9 18537910 critical splice donor site probably null
R6874:Muc16 UTSW 9 18658769 nonsense probably null
R6894:Muc16 UTSW 9 18495576 missense possibly damaging 0.92
R6913:Muc16 UTSW 9 18642663 missense unknown
R6919:Muc16 UTSW 9 18660299 missense unknown
R6953:Muc16 UTSW 9 18640529 missense probably benign 0.01
R6956:Muc16 UTSW 9 18645026 missense unknown
R6977:Muc16 UTSW 9 18645337 missense unknown
R6996:Muc16 UTSW 9 18645897 missense unknown
R7011:Muc16 UTSW 9 18637451 missense probably benign 0.26
R7011:Muc16 UTSW 9 18637543 missense probably benign 0.10
R7012:Muc16 UTSW 9 18495618 critical splice acceptor site probably null
R7014:Muc16 UTSW 9 18658236 missense unknown
R7021:Muc16 UTSW 9 18554919 missense unknown
R7021:Muc16 UTSW 9 18550831 splice site probably null
R7038:Muc16 UTSW 9 18620468 missense probably damaging 0.99
R7057:Muc16 UTSW 9 18646079 missense unknown
R7058:Muc16 UTSW 9 18639755 missense probably benign 0.10
R7066:Muc16 UTSW 9 18658021 missense unknown
R7067:Muc16 UTSW 9 18658251 missense unknown
R7070:Muc16 UTSW 9 18645923 nonsense probably null
R7074:Muc16 UTSW 9 18655650 missense unknown
R7085:Muc16 UTSW 9 18644849 missense unknown
R7088:Muc16 UTSW 9 18592680 missense probably damaging 0.99
R7107:Muc16 UTSW 9 18637298 missense probably benign 0.10
R7108:Muc16 UTSW 9 18655233 missense unknown
R7126:Muc16 UTSW 9 18641216 missense probably benign 0.01
R7128:Muc16 UTSW 9 18643004 missense unknown
R7145:Muc16 UTSW 9 18655580 missense unknown
R7179:Muc16 UTSW 9 18642008 missense probably benign 0.00
R7194:Muc16 UTSW 9 18674454 missense unknown
R7211:Muc16 UTSW 9 18498570 missense probably damaging 1.00
R7213:Muc16 UTSW 9 18641416 missense probably benign 0.01
R7217:Muc16 UTSW 9 18644076 nonsense probably null
R7221:Muc16 UTSW 9 18642199 missense probably benign 0.04
R7265:Muc16 UTSW 9 18656472 missense unknown
R7326:Muc16 UTSW 9 18585013 missense probably benign 0.03
R7359:Muc16 UTSW 9 18643020 missense unknown
R7387:Muc16 UTSW 9 18641720 missense probably benign 0.01
R7391:Muc16 UTSW 9 18639536 missense probably benign 0.04
R7398:Muc16 UTSW 9 18637742 missense possibly damaging 0.46
R7419:Muc16 UTSW 9 18641962 missense probably benign 0.01
R7431:Muc16 UTSW 9 18607993 missense
R7484:Muc16 UTSW 9 18646768 missense unknown
R7487:Muc16 UTSW 9 18584799 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- AGATTCTGCTTGACCTGGTG -3'
(R):5'- TCCAGGCAGAACAGAAAGTATTC -3'

Sequencing Primer
(F):5'- TTGACCTGGTGAAGCAGGC -3'
(R):5'- AGAAAGCCATTCAGTGACTTCTACTC -3'
Posted On2018-11-06