Incidental Mutation 'R6941:Ndst4'
ID540531
Institutional Source Beutler Lab
Gene Symbol Ndst4
Ensembl Gene ENSMUSG00000027971
Gene NameN-deacetylase/N-sulfotransferase (heparin glucosaminyl) 4
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R6941 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location125404076-125728899 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 125609511 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 422 (H422Q)
Ref Sequence ENSEMBL: ENSMUSP00000133341 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000173932]
Predicted Effect
SMART Domains Protein: ENSMUSP00000120687
Gene: ENSMUSG00000027971
AA Change: H112Q

DomainStartEndE-ValueType
Pfam:HSNSD 19 505 1.3e-270 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000173932
AA Change: H422Q

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000133341
Gene: ENSMUSG00000027971
AA Change: H422Q

DomainStartEndE-ValueType
Pfam:HSNSD 20 505 1.2e-251 PFAM
Pfam:Sulfotransfer_1 594 857 1.2e-43 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 97.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit a phenotype restricted to the colonic epithelium that includes an increased number of colon goblet cells, a decreased number of colonocytes, and increased apoptosis of colonic epithelial cells in the proximal colon. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 A T 7: 120,541,147 I1557F probably damaging Het
Acad10 A T 5: 121,649,357 D176E probably damaging Het
Acta2 A T 19: 34,252,522 V11E probably damaging Het
Ampd2 T C 3: 108,079,293 H225R probably damaging Het
Arfgef3 A G 10: 18,625,455 Y1016H possibly damaging Het
Atg7 C T 6: 114,673,678 T83M possibly damaging Het
AU018091 A G 7: 3,159,427 probably null Het
Birc2 A G 9: 7,819,468 V481A probably benign Het
C130060K24Rik G A 6: 65,447,401 M126I probably damaging Het
Cabp1 A T 5: 115,172,901 D295E probably damaging Het
Cd180 A T 13: 102,706,191 T582S probably benign Het
Cnksr3 A G 10: 7,126,758 S145P probably damaging Het
Ddx27 A G 2: 167,015,377 D15G possibly damaging Het
Dsc1 T C 18: 20,097,189 Y353C probably benign Het
Dsg1c C T 18: 20,267,923 T161I probably damaging Het
Epm2a A G 10: 11,391,085 probably null Het
Fat2 T C 11: 55,262,088 H3766R probably benign Het
Fjx1 A G 2: 102,450,558 V344A probably benign Het
Frmd3 A G 4: 74,098,126 I93V probably benign Het
Gbe1 TAGTAAGAGT TAGT 16: 70,433,556 probably benign Het
Gdf15 A G 8: 70,630,144 L104P possibly damaging Het
Glra3 G A 8: 55,940,926 R24Q probably benign Het
Gm4070 G A 7: 105,901,980 Q622* probably null Het
Ighv1-9 A T 12: 114,583,828 M31K probably benign Het
Ipmk G A 10: 71,348,090 G47S probably null Het
Itsn2 T C 12: 4,629,641 I150T probably benign Het
Kcnq5 T C 1: 21,405,844 Y545C probably damaging Het
Klk1b8 C A 7: 43,952,789 H48Q possibly damaging Het
Lrit1 G C 14: 37,060,095 V242L probably damaging Het
Lrrc34 T C 3: 30,624,820 Y376C probably benign Het
Mast4 A T 13: 102,804,714 D278E probably damaging Het
Mtmr3 T C 11: 4,487,505 Y982C possibly damaging Het
Nek7 T C 1: 138,502,638 E206G probably damaging Het
Nufip2 CCAGCAGCAGCAGCAGCAGCAG CCAGCAGCAGCAGCAGCAG 11: 77,686,296 probably benign Het
Olfr1451 T A 19: 12,999,497 N170K possibly damaging Het
Pglyrp2 T C 17: 32,416,074 Y438C probably damaging Het
Pigr G T 1: 130,847,327 W497L probably damaging Het
Pkd2l2 G T 18: 34,416,883 V194L probably benign Het
Ppp1r16b A T 2: 158,696,148 K5M probably damaging Het
Psat1 A T 19: 15,920,943 S35R probably damaging Het
Rab11fip1 G A 8: 27,156,275 Q258* probably null Het
Rad51d A G 11: 82,889,797 L53P probably damaging Het
Rell2 G A 18: 37,958,288 A169T probably benign Het
Rnf19b T C 4: 129,082,779 I545T probably benign Het
Slc12a1 G T 2: 125,214,079 E843D possibly damaging Het
Slc1a4 A G 11: 20,304,346 S507P probably damaging Het
Slc6a1 G A 6: 114,313,512 W316* probably null Het
Spesp1 A G 9: 62,272,870 L252P probably damaging Het
Sphkap G A 1: 83,408,090 probably benign Het
Srcap A G 7: 127,542,597 T1850A probably damaging Het
Supv3l1 T C 10: 62,430,586 T604A possibly damaging Het
Tacr1 A G 6: 82,403,865 T86A possibly damaging Het
Tenm3 T C 8: 48,674,416 R76G probably damaging Het
Tmprss6 C A 15: 78,446,777 A419S probably damaging Het
Usp54 T G 14: 20,562,109 I880L probably benign Het
Wwp2 T A 8: 107,548,502 V377D probably damaging Het
Zfp735 A T 11: 73,690,333 E65D probably benign Het
Zfy2 T C Y: 2,121,491 E134G probably benign Het
Other mutations in Ndst4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00920:Ndst4 APN 3 125438211 missense probably damaging 0.98
IGL00926:Ndst4 APN 3 125561453 missense probably benign 0.01
IGL01292:Ndst4 APN 3 125438754 missense probably damaging 1.00
IGL01797:Ndst4 APN 3 125683153 missense probably damaging 0.99
R0004:Ndst4 UTSW 3 125570826 missense probably benign 0.03
R0118:Ndst4 UTSW 3 125611561 nonsense probably null
R0652:Ndst4 UTSW 3 125611539 missense possibly damaging 0.93
R1437:Ndst4 UTSW 3 125561450 missense probably damaging 0.97
R1502:Ndst4 UTSW 3 125437758 start gained probably benign
R1900:Ndst4 UTSW 3 125697895 splice site probably null
R1960:Ndst4 UTSW 3 125438682 nonsense probably null
R2249:Ndst4 UTSW 3 125438174 missense probably benign 0.16
R2334:Ndst4 UTSW 3 125708176 missense possibly damaging 0.86
R2345:Ndst4 UTSW 3 125708120 missense possibly damaging 0.95
R3617:Ndst4 UTSW 3 125438133 missense probably benign 0.00
R3713:Ndst4 UTSW 3 125561505 missense possibly damaging 0.93
R3715:Ndst4 UTSW 3 125561505 missense possibly damaging 0.93
R3954:Ndst4 UTSW 3 125437905 missense probably benign 0.01
R4013:Ndst4 UTSW 3 125683170 missense probably damaging 1.00
R4035:Ndst4 UTSW 3 125438736 missense probably damaging 1.00
R4085:Ndst4 UTSW 3 125609482 missense probably benign
R4496:Ndst4 UTSW 3 125683273 missense probably damaging 1.00
R4498:Ndst4 UTSW 3 125438358 missense probably damaging 1.00
R5187:Ndst4 UTSW 3 125437911 missense probably damaging 0.98
R5233:Ndst4 UTSW 3 125710117 missense probably damaging 1.00
R5518:Ndst4 UTSW 3 125438456 missense probably benign
R5575:Ndst4 UTSW 3 125437830 missense probably benign 0.41
R5687:Ndst4 UTSW 3 125438609 missense possibly damaging 0.79
R5940:Ndst4 UTSW 3 125561419 splice site probably benign
R6027:Ndst4 UTSW 3 125713376 missense probably benign 0.38
R6406:Ndst4 UTSW 3 125438501 missense probably benign
R6540:Ndst4 UTSW 3 125722152 nonsense probably null
R7108:Ndst4 UTSW 3 125561471 missense probably damaging 0.96
R7269:Ndst4 UTSW 3 125438358 missense probably damaging 1.00
R7278:Ndst4 UTSW 3 125438303 missense probably benign 0.00
R7345:Ndst4 UTSW 3 125714659 missense probably benign 0.07
R7405:Ndst4 UTSW 3 125683216 missense probably benign
R7418:Ndst4 UTSW 3 125708151 missense probably damaging 0.99
X0027:Ndst4 UTSW 3 125437946 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCCATGAAGCTGATGGACTGAAG -3'
(R):5'- TCATGTACACAGATATCAAGGGG -3'

Sequencing Primer
(F):5'- TGGACTGAAGAAAGATTAAAATCTCC -3'
(R):5'- TATCAAGGGGAGGCAGACAC -3'
Posted On2018-11-06