Incidental Mutation 'R6943:Nbr1'
ID540672
Institutional Source Beutler Lab
Gene Symbol Nbr1
Ensembl Gene ENSMUSG00000017119
Gene Nameneighbor of Brca1 gene 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6943 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location101552149-101581951 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 101577951 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 878 (I878F)
Ref Sequence ENSEMBL: ENSMUSP00000102830 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039581] [ENSMUST00000071537] [ENSMUST00000100403] [ENSMUST00000103098] [ENSMUST00000103099] [ENSMUST00000107194] [ENSMUST00000107208] [ENSMUST00000107212] [ENSMUST00000107213] [ENSMUST00000107218] [ENSMUST00000123558] [ENSMUST00000128614]
Predicted Effect probably benign
Transcript: ENSMUST00000039581
SMART Domains Protein: ENSMUSP00000045832
Gene: ENSMUSG00000034947

DomainStartEndE-ValueType
Pfam:DUF1356 11 251 2.2e-89 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000071537
AA Change: I903F

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000071467
Gene: ENSMUSG00000017119
AA Change: I903F

DomainStartEndE-ValueType
PB1 4 86 2.05e-8 SMART
ZnF_ZZ 212 257 1.21e-13 SMART
coiled coil region 291 330 N/A INTRINSIC
Pfam:N_BRCA1_IG 378 479 7.1e-34 PFAM
low complexity region 507 518 N/A INTRINSIC
coiled coil region 714 744 N/A INTRINSIC
PDB:2MJ5|B 935 981 2e-24 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000100403
SMART Domains Protein: ENSMUSP00000097971
Gene: ENSMUSG00000034947

DomainStartEndE-ValueType
Pfam:DUF1356 24 251 1e-111 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000103098
AA Change: I903F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000099387
Gene: ENSMUSG00000017119
AA Change: I903F

DomainStartEndE-ValueType
PB1 4 86 7.02e-16 SMART
ZnF_ZZ 212 257 1.21e-13 SMART
coiled coil region 291 330 N/A INTRINSIC
PDB:4OLE|D 368 486 5e-77 PDB
low complexity region 507 518 N/A INTRINSIC
coiled coil region 714 744 N/A INTRINSIC
PDB:2MJ5|B 935 981 2e-24 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000103099
AA Change: I903F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000099388
Gene: ENSMUSG00000017119
AA Change: I903F

DomainStartEndE-ValueType
PB1 4 86 7.02e-16 SMART
ZnF_ZZ 212 257 1.21e-13 SMART
coiled coil region 291 330 N/A INTRINSIC
PDB:4OLE|D 368 486 5e-77 PDB
low complexity region 507 518 N/A INTRINSIC
coiled coil region 714 744 N/A INTRINSIC
PDB:2MJ5|B 935 981 2e-24 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000107194
SMART Domains Protein: ENSMUSP00000102812
Gene: ENSMUSG00000034947

DomainStartEndE-ValueType
Pfam:DUF1356 11 171 4.8e-62 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107208
SMART Domains Protein: ENSMUSP00000102826
Gene: ENSMUSG00000017119

DomainStartEndE-ValueType
PB1 4 86 7.02e-16 SMART
ZnF_ZZ 212 257 1.21e-13 SMART
coiled coil region 291 330 N/A INTRINSIC
PDB:4OLE|D 368 486 1e-77 PDB
low complexity region 507 518 N/A INTRINSIC
coiled coil region 714 744 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107212
AA Change: I878F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102830
Gene: ENSMUSG00000017119
AA Change: I878F

DomainStartEndE-ValueType
PB1 4 86 7.02e-16 SMART
ZnF_ZZ 212 257 1.21e-13 SMART
coiled coil region 291 330 N/A INTRINSIC
PDB:4OLE|D 368 486 3e-77 PDB
low complexity region 507 518 N/A INTRINSIC
coiled coil region 689 719 N/A INTRINSIC
PDB:2MJ5|B 910 956 2e-24 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000107213
AA Change: I866F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000102831
Gene: ENSMUSG00000017119
AA Change: I866F

DomainStartEndE-ValueType
PB1 4 86 7.02e-16 SMART
ZnF_ZZ 212 257 1.21e-13 SMART
coiled coil region 291 330 N/A INTRINSIC
PDB:4OLE|D 368 486 2e-77 PDB
low complexity region 507 518 N/A INTRINSIC
coiled coil region 677 707 N/A INTRINSIC
PDB:2MJ5|B 898 944 2e-24 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000107218
AA Change: I903F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000102836
Gene: ENSMUSG00000017119
AA Change: I903F

DomainStartEndE-ValueType
PB1 4 86 7.02e-16 SMART
ZnF_ZZ 212 257 1.21e-13 SMART
coiled coil region 291 330 N/A INTRINSIC
PDB:4OLE|D 368 486 5e-77 PDB
low complexity region 507 518 N/A INTRINSIC
coiled coil region 714 744 N/A INTRINSIC
PDB:2MJ5|B 935 981 2e-24 PDB
Predicted Effect silent
Transcript: ENSMUST00000123558
SMART Domains Protein: ENSMUSP00000133619
Gene: ENSMUSG00000017119

DomainStartEndE-ValueType
PB1 4 86 7.02e-16 SMART
ZnF_ZZ 212 257 1.21e-13 SMART
coiled coil region 291 330 N/A INTRINSIC
PDB:4OLE|D 368 486 2e-77 PDB
low complexity region 507 518 N/A INTRINSIC
coiled coil region 714 744 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128614
SMART Domains Protein: ENSMUSP00000122218
Gene: ENSMUSG00000034947

DomainStartEndE-ValueType
Pfam:DUF1356 11 156 8.4e-57 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000119900
Gene: ENSMUSG00000017119
AA Change: I626F

DomainStartEndE-ValueType
coiled coil region 50 89 N/A INTRINSIC
Pfam:N_BRCA1_IG 138 239 2.3e-34 PFAM
low complexity region 267 278 N/A INTRINSIC
coiled coil region 473 500 N/A INTRINSIC
PDB:2MJ5|B 659 705 1e-24 PDB
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 98.9%
  • 20x: 96.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene was originally identified as an ovarian tumor antigen monitored in ovarian cancer. The encoded protein contains a B-box/coiled-coil motif, which is present in many genes with transformation potential. It functions as a specific autophagy receptor for the selective autophagic degradation of peroxisomes by forming intracellular inclusions with ubiquitylated autophagic substrates. This gene is located on a region of chromosome 17q21.1 that is in close proximity to the BRCA1 tumor suppressor gene. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Apr 2014]
PHENOTYPE: Homozygous mice of the genetic truncation allele had an age-dependent increase in bone mass and bone mineral density. Mice homozygous for a floxed allele activated in T cells exhibit decreased ovalbumin-induced inflammation and defective Th2 polarization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aacs T A 5: 125,506,298 probably null Het
Arhgef1 A G 7: 24,923,731 I423V probably benign Het
Aspm T C 1: 139,480,542 L2389P probably damaging Het
B4galt1 T C 4: 40,812,860 M222V probably benign Het
Bsn C A 9: 108,107,817 G3013C unknown Het
Camsap2 T C 1: 136,304,449 H136R probably damaging Het
Ccar1 A G 10: 62,746,936 V1047A unknown Het
Ccdc80 A G 16: 45,095,082 E67G probably benign Het
Ces3b G T 8: 105,093,078 G511V probably damaging Het
Cops6 T A 5: 138,163,528 H224Q probably benign Het
Dnah5 A T 15: 28,235,720 D331V probably damaging Het
Dupd1 T C 14: 21,677,067 D171G probably damaging Het
Echs1 G A 7: 140,108,094 T266I probably damaging Het
Ehmt2 G A 17: 34,911,430 C1017Y probably damaging Het
Epb41l5 C T 1: 119,609,129 R344Q probably damaging Het
Fcgbp G A 7: 28,092,052 V913I probably benign Het
Foxd4 A G 19: 24,899,876 F320S probably damaging Het
Frmpd4 C T X: 167,604,583 R133K probably damaging Het
Glmp A G 3: 88,326,610 Y258C probably damaging Het
Gm4070 G A 7: 105,901,980 Q622* probably null Het
Gphn C G 12: 78,492,181 S200R possibly damaging Het
H2-Q7 T G 17: 35,439,584 M66R probably benign Het
Hivep2 T A 10: 14,128,314 C219S probably damaging Het
Hlcs A T 16: 94,141,402 M90K possibly damaging Het
Itga8 C A 2: 12,155,371 probably null Het
Klrk1 T A 6: 129,621,240 M1L possibly damaging Het
Kmo T A 1: 175,658,375 F385I probably benign Het
Lrit1 G C 14: 37,060,095 V242L probably damaging Het
Lrrc3c A G 11: 98,599,249 D144G probably damaging Het
Lyzl4 C T 9: 121,582,981 W123* probably null Het
Map3k1 A G 13: 111,772,712 S77P probably benign Het
Mark1 T C 1: 184,898,787 T709A probably damaging Het
Nedd1 A T 10: 92,711,306 H118Q probably damaging Het
Nfatc1 C T 18: 80,635,555 G873S probably damaging Het
Ngly1 T G 14: 16,283,467 N415K probably damaging Het
Nol6 C A 4: 41,118,962 R677L probably damaging Het
Nop9 T C 14: 55,752,813 V471A probably benign Het
Notch4 A G 17: 34,583,603 N1333D probably benign Het
Nsun2 G A 13: 69,630,033 G478R probably damaging Het
Olfr1036 T C 2: 86,074,920 F60S probably damaging Het
Olfr248 T A 1: 174,391,841 Y257* probably null Het
Olfr51 T A 11: 51,007,326 M118K probably damaging Het
Olfr954 A T 9: 39,461,863 Y144F probably benign Het
Pcp4l1 T C 1: 171,174,453 E46G possibly damaging Het
Plek2 T C 12: 78,889,309 probably null Het
Rbl1 T G 2: 157,188,286 I434L probably benign Het
Ryr2 A G 13: 11,566,948 V4777A possibly damaging Het
Sgk1 T C 10: 21,882,694 F19S probably damaging Het
Stard9 C T 2: 120,702,196 A2978V probably benign Het
Syne1 T C 10: 5,083,940 T7711A probably benign Het
Taf10 G A 7: 105,744,176 T48I probably benign Het
Tgfbi T G 13: 56,637,176 S649A possibly damaging Het
Thbs3 T C 3: 89,224,864 V749A probably benign Het
Tmem241 G T 18: 12,047,584 H218N possibly damaging Het
Tmem266 C T 9: 55,377,567 probably benign Het
Tnc T C 4: 63,982,745 I1586M probably damaging Het
Ubr4 T A 4: 139,437,131 C2676* probably null Het
Unc13a A T 8: 71,652,377 I747N probably damaging Het
Vangl1 A T 3: 102,165,781 probably benign Het
Vmn1r184 C T 7: 26,267,138 T103I possibly damaging Het
Vmn1r204 T C 13: 22,556,304 V35A probably benign Het
Vps13b A G 15: 35,448,689 H603R possibly damaging Het
Zfp105 A G 9: 122,925,238 D44G probably benign Het
Zfp11 T C 5: 129,658,088 H103R probably damaging Het
Zfp335 A G 2: 164,894,875 F947L possibly damaging Het
Other mutations in Nbr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02187:Nbr1 APN 11 101569359 missense possibly damaging 0.91
IGL02192:Nbr1 APN 11 101569591 missense probably damaging 1.00
IGL02259:Nbr1 APN 11 101577990 missense probably damaging 0.99
IGL02951:Nbr1 APN 11 101571979 critical splice donor site probably null
IGL02994:Nbr1 APN 11 101556227 missense probably damaging 1.00
R0087:Nbr1 UTSW 11 101564693 missense probably benign 0.16
R0630:Nbr1 UTSW 11 101567087 unclassified probably benign
R0723:Nbr1 UTSW 11 101576319 nonsense probably null
R0733:Nbr1 UTSW 11 101576371 missense probably benign 0.00
R1482:Nbr1 UTSW 11 101572841 missense probably benign 0.34
R1567:Nbr1 UTSW 11 101575211 missense probably damaging 0.98
R1570:Nbr1 UTSW 11 101564830 unclassified probably benign
R1668:Nbr1 UTSW 11 101569766 missense probably benign 0.00
R1759:Nbr1 UTSW 11 101559543 missense probably damaging 1.00
R1903:Nbr1 UTSW 11 101575152 missense probably damaging 0.98
R1927:Nbr1 UTSW 11 101567214 missense possibly damaging 0.78
R2131:Nbr1 UTSW 11 101566191 unclassified probably null
R2211:Nbr1 UTSW 11 101567264 critical splice donor site probably null
R2255:Nbr1 UTSW 11 101572817 missense possibly damaging 0.80
R4270:Nbr1 UTSW 11 101567222 missense possibly damaging 0.87
R4271:Nbr1 UTSW 11 101567222 missense possibly damaging 0.87
R4710:Nbr1 UTSW 11 101575275 missense probably damaging 1.00
R4947:Nbr1 UTSW 11 101575077 missense probably benign 0.06
R5468:Nbr1 UTSW 11 101572464 missense probably benign 0.10
R5554:Nbr1 UTSW 11 101564807 missense probably benign 0.34
R5771:Nbr1 UTSW 11 101559538 missense probably damaging 1.00
R6119:Nbr1 UTSW 11 101567112 unclassified probably null
R6400:Nbr1 UTSW 11 101565774 missense probably damaging 1.00
R6603:Nbr1 UTSW 11 101556105 unclassified probably benign
R7347:Nbr1 UTSW 11 101569321 nonsense probably null
X0019:Nbr1 UTSW 11 101567124 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- TGTGCGTTTCCTGCAGTAC -3'
(R):5'- TTGCCAATCCAGACAGAAGG -3'

Sequencing Primer
(F):5'- GCAGTACTCAGGTCTTCTGCCAG -3'
(R):5'- AAGGACTGCCATTTGCAC -3'
Posted On2018-11-06