Incidental Mutation 'R6943:Map3k1'
ID540679
Institutional Source Beutler Lab
Gene Symbol Map3k1
Ensembl Gene ENSMUSG00000021754
Gene Namemitogen-activated protein kinase kinase kinase 1
SynonymsMekk, MEKK1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.901) question?
Stock #R6943 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location111746428-111808993 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 111772712 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 77 (S77P)
Ref Sequence ENSEMBL: ENSMUSP00000117863 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109267] [ENSMUST00000145055]
Predicted Effect probably benign
Transcript: ENSMUST00000109267
AA Change: S235P

PolyPhen 2 Score 0.301 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000104890
Gene: ENSMUSG00000021754
AA Change: S235P

DomainStartEndE-ValueType
low complexity region 2 46 N/A INTRINSIC
low complexity region 85 101 N/A INTRINSIC
low complexity region 112 122 N/A INTRINSIC
low complexity region 138 158 N/A INTRINSIC
low complexity region 235 256 N/A INTRINSIC
Pfam:SWIM 333 361 3.1e-7 PFAM
low complexity region 417 426 N/A INTRINSIC
RING 438 486 2.69e-1 SMART
low complexity region 512 527 N/A INTRINSIC
low complexity region 596 625 N/A INTRINSIC
low complexity region 750 762 N/A INTRINSIC
low complexity region 967 978 N/A INTRINSIC
low complexity region 1073 1084 N/A INTRINSIC
low complexity region 1160 1178 N/A INTRINSIC
S_TKc 1224 1489 9.58e-85 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000145055
AA Change: S77P

PolyPhen 2 Score 0.301 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000117863
Gene: ENSMUSG00000021754
AA Change: S77P

DomainStartEndE-ValueType
low complexity region 77 98 N/A INTRINSIC
Pfam:SWIM 175 203 2.2e-8 PFAM
low complexity region 259 264 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 98.9%
  • 20x: 96.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a serine/threonine kinase and is part of some signal transduction cascades, including the ERK and JNK kinase pathways as well as the NF-kappa-B pathway. The encoded protein is activated by autophosphorylation and requires magnesium as a cofactor in phosphorylating other proteins. This protein has E3 ligase activity conferred by a plant homeodomain (PHD) in its N-terminus and phospho-kinase activity conferred by a kinase domain in its C-terminus. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for a spontaneous allele are born with one or both eyes open, defects in eye morphology, and defects in ear morphology and function. Mice homozygous for a knock-out allele are born with open eyes and exhibit increased response to aortic banding and blood vessel healing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aacs T A 5: 125,506,298 probably null Het
Arhgef1 A G 7: 24,923,731 I423V probably benign Het
Aspm T C 1: 139,480,542 L2389P probably damaging Het
B4galt1 T C 4: 40,812,860 M222V probably benign Het
Bsn C A 9: 108,107,817 G3013C unknown Het
Camsap2 T C 1: 136,304,449 H136R probably damaging Het
Ccar1 A G 10: 62,746,936 V1047A unknown Het
Ccdc80 A G 16: 45,095,082 E67G probably benign Het
Ces3b G T 8: 105,093,078 G511V probably damaging Het
Cops6 T A 5: 138,163,528 H224Q probably benign Het
Dnah5 A T 15: 28,235,720 D331V probably damaging Het
Dupd1 T C 14: 21,677,067 D171G probably damaging Het
Echs1 G A 7: 140,108,094 T266I probably damaging Het
Ehmt2 G A 17: 34,911,430 C1017Y probably damaging Het
Epb41l5 C T 1: 119,609,129 R344Q probably damaging Het
Fcgbp G A 7: 28,092,052 V913I probably benign Het
Foxd4 A G 19: 24,899,876 F320S probably damaging Het
Frmpd4 C T X: 167,604,583 R133K probably damaging Het
Glmp A G 3: 88,326,610 Y258C probably damaging Het
Gm4070 G A 7: 105,901,980 Q622* probably null Het
Gphn C G 12: 78,492,181 S200R possibly damaging Het
H2-Q7 T G 17: 35,439,584 M66R probably benign Het
Hivep2 T A 10: 14,128,314 C219S probably damaging Het
Hlcs A T 16: 94,141,402 M90K possibly damaging Het
Itga8 C A 2: 12,155,371 probably null Het
Klrk1 T A 6: 129,621,240 M1L possibly damaging Het
Kmo T A 1: 175,658,375 F385I probably benign Het
Lrit1 G C 14: 37,060,095 V242L probably damaging Het
Lrrc3c A G 11: 98,599,249 D144G probably damaging Het
Lyzl4 C T 9: 121,582,981 W123* probably null Het
Mark1 T C 1: 184,898,787 T709A probably damaging Het
Nbr1 A T 11: 101,577,951 I878F probably damaging Het
Nedd1 A T 10: 92,711,306 H118Q probably damaging Het
Nfatc1 C T 18: 80,635,555 G873S probably damaging Het
Ngly1 T G 14: 16,283,467 N415K probably damaging Het
Nol6 C A 4: 41,118,962 R677L probably damaging Het
Nop9 T C 14: 55,752,813 V471A probably benign Het
Notch4 A G 17: 34,583,603 N1333D probably benign Het
Nsun2 G A 13: 69,630,033 G478R probably damaging Het
Olfr1036 T C 2: 86,074,920 F60S probably damaging Het
Olfr248 T A 1: 174,391,841 Y257* probably null Het
Olfr51 T A 11: 51,007,326 M118K probably damaging Het
Olfr954 A T 9: 39,461,863 Y144F probably benign Het
Pcp4l1 T C 1: 171,174,453 E46G possibly damaging Het
Plek2 T C 12: 78,889,309 probably null Het
Rbl1 T G 2: 157,188,286 I434L probably benign Het
Ryr2 A G 13: 11,566,948 V4777A possibly damaging Het
Sgk1 T C 10: 21,882,694 F19S probably damaging Het
Stard9 C T 2: 120,702,196 A2978V probably benign Het
Syne1 T C 10: 5,083,940 T7711A probably benign Het
Taf10 G A 7: 105,744,176 T48I probably benign Het
Tgfbi T G 13: 56,637,176 S649A possibly damaging Het
Thbs3 T C 3: 89,224,864 V749A probably benign Het
Tmem241 G T 18: 12,047,584 H218N possibly damaging Het
Tmem266 C T 9: 55,377,567 probably benign Het
Tnc T C 4: 63,982,745 I1586M probably damaging Het
Ubr4 T A 4: 139,437,131 C2676* probably null Het
Unc13a A T 8: 71,652,377 I747N probably damaging Het
Vangl1 A T 3: 102,165,781 probably benign Het
Vmn1r184 C T 7: 26,267,138 T103I possibly damaging Het
Vmn1r204 T C 13: 22,556,304 V35A probably benign Het
Vps13b A G 15: 35,448,689 H603R possibly damaging Het
Zfp105 A G 9: 122,925,238 D44G probably benign Het
Zfp11 T C 5: 129,658,088 H103R probably damaging Het
Zfp335 A G 2: 164,894,875 F947L possibly damaging Het
Other mutations in Map3k1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01594:Map3k1 APN 13 111758189 critical splice acceptor site probably null
IGL01686:Map3k1 APN 13 111754662 missense possibly damaging 0.51
IGL02104:Map3k1 APN 13 111756243 missense probably damaging 0.99
IGL03071:Map3k1 APN 13 111755525 missense possibly damaging 0.77
IGL03087:Map3k1 APN 13 111749025 missense probably benign 0.01
IGL03213:Map3k1 APN 13 111748892 utr 3 prime probably benign
R0005:Map3k1 UTSW 13 111755704 missense probably benign 0.00
R0025:Map3k1 UTSW 13 111756129 missense probably benign
R0506:Map3k1 UTSW 13 111755764 nonsense probably null
R0540:Map3k1 UTSW 13 111763510 missense probably benign 0.05
R0607:Map3k1 UTSW 13 111763510 missense probably benign 0.05
R0898:Map3k1 UTSW 13 111767956 unclassified probably benign
R1171:Map3k1 UTSW 13 111755643 missense probably benign 0.29
R1464:Map3k1 UTSW 13 111755871 missense possibly damaging 0.67
R1464:Map3k1 UTSW 13 111755871 missense possibly damaging 0.67
R1682:Map3k1 UTSW 13 111757150 missense probably damaging 1.00
R1718:Map3k1 UTSW 13 111755419 missense probably benign 0.23
R1893:Map3k1 UTSW 13 111768033 missense possibly damaging 0.91
R2174:Map3k1 UTSW 13 111752482 missense possibly damaging 0.75
R2215:Map3k1 UTSW 13 111755788 missense probably benign 0.00
R2239:Map3k1 UTSW 13 111748944 missense probably benign 0.00
R3686:Map3k1 UTSW 13 111753891 missense probably damaging 0.99
R3783:Map3k1 UTSW 13 111756220 missense probably benign 0.00
R4094:Map3k1 UTSW 13 111756162 missense possibly damaging 0.48
R4231:Map3k1 UTSW 13 111768494 missense probably benign 0.01
R4902:Map3k1 UTSW 13 111772612 missense probably damaging 0.99
R4967:Map3k1 UTSW 13 111772738 missense probably damaging 0.96
R5465:Map3k1 UTSW 13 111756120 missense probably benign 0.20
R5855:Map3k1 UTSW 13 111755979 missense probably benign 0.37
R6384:Map3k1 UTSW 13 111750530 missense probably damaging 1.00
R6389:Map3k1 UTSW 13 111769441 missense probably damaging 1.00
R6400:Map3k1 UTSW 13 111755725 missense probably damaging 0.99
R6509:Map3k1 UTSW 13 111753829 missense possibly damaging 0.48
R6644:Map3k1 UTSW 13 111752449 missense probably benign 0.07
R6900:Map3k1 UTSW 13 111753816 missense probably benign 0.01
R6946:Map3k1 UTSW 13 111768501 nonsense probably null
R7059:Map3k1 UTSW 13 111772778 missense probably benign
R7271:Map3k1 UTSW 13 111756697 missense probably benign 0.32
R7290:Map3k1 UTSW 13 111768111 missense probably damaging 1.00
R7397:Map3k1 UTSW 13 111755208 missense probably damaging 0.98
X0065:Map3k1 UTSW 13 111757105 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTACCCTCTGTGTGTCGTGAAC -3'
(R):5'- AAGTGTGACCTGTTACCTGGAATATC -3'

Sequencing Primer
(F):5'- TCGTGAACGAGCCAAAGAC -3'
(R):5'- GATGGTCAGATGTGCTTC -3'
Posted On2018-11-06