Mutagenetix > Incidental Mutation

Incidental Mutation 'R6418:Muc6'

540695

Institutional Source

Beutler Lab

Gene Symbol

Muc6

Ensembl Gene

ENSMUSG00000048191

Gene Name

mucin 6, gastric

Synonyms

MMRRC Submission

044560-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.097) question?

Stock #

R6418 (G1)

Quality Score

41.0074

Status

Validated

Chromosome

Chromosomal Location

141213373-141241641 bp(-) (GRCm39)

Type of Mutation

intron

DNA Base Change (assembly)

A to C at 141224032 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000140388 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000062451] [ENSMUST00000189314] [ENSMUST00000190907]

AlphaFold

no structure available at present

Predicted Effect

unknown
Transcript: ENSMUST00000062451
AA Change: S1652A

SMART Domains

Protein: ENSMUSP00000049941
Gene: ENSMUSG00000048191
AA Change: S1652A

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
VWD	29	234	2.49e-14	SMART
C8	267	340	5.46e-3	SMART
Pfam:TIL	344	399	5.6e-14	PFAM
VWC	401	469	2.57e-7	SMART
VWD	428	591	4.81e-30	SMART
C8	627	703	8.84e-21	SMART
SCOP:d1coua_	706	769	7e-9	SMART
Pfam:TIL	806	869	1.9e-9	PFAM
VWC	871	941	8.52e-3	SMART
VWD	898	1060	1.59e-30	SMART
C8	1096	1170	5.52e-31	SMART
Blast:CT	1184	1236	2e-19	BLAST
low complexity region	1240	1269	N/A	INTRINSIC
low complexity region	1275	1293	N/A	INTRINSIC
low complexity region	1313	1337	N/A	INTRINSIC
low complexity region	1345	1374	N/A	INTRINSIC
internal_repeat_3	1375	1560	6.78e-17	PROSPERO
internal_repeat_2	1426	1751	8.94e-34	PROSPERO
low complexity region	1761	1780	N/A	INTRINSIC
low complexity region	1867	1887	N/A	INTRINSIC
low complexity region	1896	1910	N/A	INTRINSIC
low complexity region	1912	1946	N/A	INTRINSIC
low complexity region	1990	2004	N/A	INTRINSIC
low complexity region	2010	2020	N/A	INTRINSIC
internal_repeat_2	2036	2430	8.94e-34	PROSPERO
internal_repeat_3	2329	2516	6.78e-17	PROSPERO
low complexity region	2519	2536	N/A	INTRINSIC
low complexity region	2564	2587	N/A	INTRINSIC
low complexity region	2605	2630	N/A	INTRINSIC
low complexity region	2642	2677	N/A	INTRINSIC
low complexity region	2729	2762	N/A	INTRINSIC
Blast:CT	2765	2852	1e-44	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000189314

SMART Domains

Protein: ENSMUSP00000140388
Gene: ENSMUSG00000048191

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
VWD	29	193	2.64e-27	SMART
C8	226	299	5.46e-3	SMART
Pfam:TIL	303	358	1.4e-13	PFAM
VWC	360	428	2.57e-7	SMART
VWD	387	550	4.81e-30	SMART
C8	586	662	8.84e-21	SMART
internal_repeat_2	665	754	5.76e-7	PROSPERO
Pfam:TIL	765	828	6.4e-9	PFAM
VWC	830	900	8.52e-3	SMART
VWD	857	1019	1.59e-30	SMART
C8	1055	1129	5.52e-31	SMART
low complexity region	1199	1228	N/A	INTRINSIC
low complexity region	1234	1252	N/A	INTRINSIC
low complexity region	1272	1296	N/A	INTRINSIC
low complexity region	1304	1333	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000190907
AA Change: S1717A

SMART Domains

Protein: ENSMUSP00000140483
Gene: ENSMUSG00000048191
AA Change: S1717A

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
VWD	29	234	1.2e-16	SMART
C8	267	340	4.2e-7	SMART
Pfam:TIL	344	399	7.2e-11	PFAM
VWC_def	401	469	1.2e-9	SMART
VWD	428	591	2.4e-32	SMART
C8	627	703	6.7e-25	SMART
SCOP:d1coua_	706	769	5e-9	SMART
Pfam:TIL	806	869	3.3e-6	PFAM
VWC_def	871	941	4.1e-5	SMART
VWD	898	1060	7.7e-33	SMART
C8	1096	1170	4.2e-35	SMART
Blast:CT	1184	1236	2e-19	BLAST
low complexity region	1240	1269	N/A	INTRINSIC
low complexity region	1275	1293	N/A	INTRINSIC
low complexity region	1313	1337	N/A	INTRINSIC
low complexity region	1345	1374	N/A	INTRINSIC
low complexity region	1406	1419	N/A	INTRINSIC
internal_repeat_1	1426	1822	3.44e-48	PROSPERO
low complexity region	1826	1845	N/A	INTRINSIC
low complexity region	1932	1952	N/A	INTRINSIC
low complexity region	1961	1975	N/A	INTRINSIC
low complexity region	1977	2011	N/A	INTRINSIC
low complexity region	2055	2069	N/A	INTRINSIC
low complexity region	2075	2085	N/A	INTRINSIC
internal_repeat_1	2101	2501	3.44e-48	PROSPERO
low complexity region	2504	2524	N/A	INTRINSIC
low complexity region	2584	2601	N/A	INTRINSIC
low complexity region	2629	2652	N/A	INTRINSIC
low complexity region	2670	2695	N/A	INTRINSIC
low complexity region	2707	2742	N/A	INTRINSIC
low complexity region	2794	2827	N/A	INTRINSIC
Blast:CT	2830	2917	1e-44	BLAST

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.0%
20x: 93.8%

Validation Efficiency

99% (67/68)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the mucin protein family. Mucins are high molecular weight glycoproteins produced by many epithelial tissues. The protein encoded by this gene is secreted and forms an insoluble mucous barrier that protects the gut lumen. [provided by RefSeq, Dec 2016]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930507D05Rik	C	T	10: 62,285,441 (GRCm39)	A55V	unknown	Het
Adra1b	T	G	11: 43,667,028 (GRCm39)	D403A	probably benign	Het
Ankdd1b	A	T	13: 96,597,405 (GRCm39)	L9Q	probably damaging	Het
Ankrd17	A	T	5: 90,426,204 (GRCm39)	S789R	possibly damaging	Het
B3galnt1	A	G	3: 69,482,326 (GRCm39)	S312P	probably damaging	Het
C4bp	C	T	1: 130,583,750 (GRCm39)	V73M	probably damaging	Het
Ccdc121rt2	T	C	5: 112,598,019 (GRCm39)	S189P	probably benign	Het
Cenpe	T	A	3: 134,957,305 (GRCm39)	N1854K	probably damaging	Het
Chrm2	A	C	6: 36,500,674 (GRCm39)	Y177S	probably damaging	Het
Clca4b	C	T	3: 144,633,996 (GRCm39)	V140I	probably benign	Het
Csad	A	G	15: 102,087,958 (GRCm39)	S322P	probably damaging	Het
Depdc1b	T	G	13: 108,493,956 (GRCm39)	Y115D	probably damaging	Het
Dnah17	T	C	11: 118,020,023 (GRCm39)	Y8C	probably damaging	Het
Dsg3	T	C	18: 20,656,817 (GRCm39)		probably null	Het
Elf5	A	G	2: 103,269,697 (GRCm39)	T93A	possibly damaging	Het
Eogt	C	T	6: 97,122,353 (GRCm39)	D27N	possibly damaging	Het
Fam118b	T	C	9: 35,146,633 (GRCm39)	D78G	probably damaging	Het
Fhip2a	T	A	19: 57,370,166 (GRCm39)	M470K	probably benign	Het
Frem3	A	G	8: 81,337,781 (GRCm39)	T25A	probably benign	Het
Gab1	C	A	8: 81,515,226 (GRCm39)	R364L	possibly damaging	Het
Golm1	T	C	13: 59,813,375 (GRCm39)	Y32C	probably damaging	Het
Has1	A	T	17: 18,070,207 (GRCm39)	V238E	probably damaging	Het
Hkdc1	T	C	10: 62,219,583 (GRCm39)	R907G	possibly damaging	Het
Igkv4-61	C	A	6: 69,394,138 (GRCm39)	A31S	possibly damaging	Het
Krtap24-1	C	T	16: 88,408,761 (GRCm39)	V122I	probably damaging	Het
Lrrc10	T	G	10: 116,881,616 (GRCm39)	L97V	probably damaging	Het
Map3k20	T	A	2: 72,232,457 (GRCm39)	M371K	probably benign	Het
Mis18bp1	A	T	12: 65,205,317 (GRCm39)	M2K	possibly damaging	Het
Mob3b	T	A	4: 34,954,049 (GRCm39)		probably null	Het
Muc4	A	G	16: 32,570,607 (GRCm39)	T556A	possibly damaging	Het
Ncapg	A	T	5: 45,839,158 (GRCm39)	L519F	probably damaging	Het
Nfix	A	G	8: 85,453,778 (GRCm39)	S265P	probably benign	Het
Or13p10	T	A	4: 118,522,808 (GRCm39)	F31L	possibly damaging	Het
Or4c121	T	C	2: 89,023,823 (GRCm39)	K185R	probably damaging	Het
Or4k49	T	C	2: 111,494,817 (GRCm39)	V82A	probably benign	Het
Or52e5	T	C	7: 104,719,514 (GRCm39)	L280P	probably damaging	Het
Or8g35	C	A	9: 39,381,112 (GRCm39)	K303N	probably benign	Het
Osgin2	T	C	4: 16,006,410 (GRCm39)	T95A	probably benign	Het
Parp4	T	C	14: 56,858,108 (GRCm39)		probably null	Het
Pcdh7	G	A	5: 57,879,046 (GRCm39)	G867D	probably damaging	Het
Pcdhb22	T	C	18: 37,652,959 (GRCm39)	S476P	possibly damaging	Het
Phldb1	A	G	9: 44,623,197 (GRCm39)	I619T	probably damaging	Het
Ppp1r13l	C	T	7: 19,105,256 (GRCm39)	R343C	probably damaging	Het
Rab2b	T	A	14: 52,506,164 (GRCm39)		probably benign	Het
Rims2	A	T	15: 39,373,092 (GRCm39)	E972V	probably damaging	Het
Slc26a9	G	T	1: 131,686,228 (GRCm39)	C337F	probably benign	Het
Spty2d1	A	G	7: 46,647,751 (GRCm39)	S393P	probably damaging	Het
Stkld1	A	T	2: 26,831,093 (GRCm39)	N90I	possibly damaging	Het
Svep1	T	A	4: 58,053,126 (GRCm39)	R3406S	probably benign	Het
Svil	A	T	18: 5,040,171 (GRCm39)	D48V	probably benign	Het
Thsd7a	T	A	6: 12,555,081 (GRCm39)	K268*	probably null	Het
Tmc6	A	G	11: 117,661,326 (GRCm39)	L618P	probably damaging	Het
Tmem231	G	A	8: 112,653,524 (GRCm39)		probably benign	Het
Ube2q2l	C	A	6: 136,378,099 (GRCm39)	D244Y	probably damaging	Het
Ubn1	A	G	16: 4,899,791 (GRCm39)	H1101R	probably benign	Het
Upf2	G	A	2: 6,032,150 (GRCm39)	V899I	unknown	Het
Ush2a	A	T	1: 188,360,763 (GRCm39)	N2161I	probably damaging	Het
Usp25	A	T	16: 76,859,330 (GRCm39)	D276V	probably damaging	Het
Vmn2r68	T	A	7: 84,882,915 (GRCm39)	H279L	probably benign	Het
Vps13d	G	A	4: 144,818,850 (GRCm39)	R3019W	probably damaging	Het
Vsig10	A	T	5: 117,486,361 (GRCm39)	E423D	probably benign	Het
Wdfy2	T	A	14: 63,162,582 (GRCm39)	F95I	probably benign	Het
Xrn1	A	G	9: 95,915,763 (GRCm39)		probably null	Het
Zdhhc13	A	G	7: 48,461,149 (GRCm39)	T362A	possibly damaging	Het
Zfp984	C	T	4: 147,845,703 (GRCm39)	S2N	probably benign	Het

Other mutations in Muc6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00091:Muc6	APN	7	141,218,497 (GRCm39)	missense	probably benign	0.06
IGL00466:Muc6	APN	7	141,232,169 (GRCm39)	missense	possibly damaging	0.94
IGL00990:Muc6	APN	7	141,638,890 (GRCm38)	missense	possibly damaging	0.85
IGL01013:Muc6	APN	7	141,234,333 (GRCm39)	nonsense	probably null
IGL01021:Muc6	APN	7	141,217,075 (GRCm39)	missense	possibly damaging	0.53
IGL01061:Muc6	APN	7	141,234,720 (GRCm39)	missense	probably damaging	1.00
IGL01294:Muc6	APN	7	141,232,926 (GRCm39)	missense	probably damaging	1.00
IGL01449:Muc6	APN	7	141,218,527 (GRCm39)	missense	possibly damaging	0.92
IGL01474:Muc6	APN	7	141,237,572 (GRCm39)	missense	probably damaging	1.00
IGL01539:Muc6	APN	7	141,236,306 (GRCm39)	missense	probably benign	0.07
IGL01541:Muc6	APN	7	141,236,069 (GRCm39)	nonsense	probably null
IGL01810:Muc6	APN	7	141,237,327 (GRCm39)	missense	probably damaging	0.97
IGL01941:Muc6	APN	7	141,218,497 (GRCm39)	missense	probably benign	0.06
IGL01954:Muc6	APN	7	141,218,497 (GRCm39)	missense	probably benign	0.06
IGL02096:Muc6	APN	7	141,226,117 (GRCm39)	intron	probably benign
IGL02192:Muc6	APN	7	141,217,717 (GRCm39)	missense	possibly damaging	0.91
IGL02217:Muc6	APN	7	141,235,889 (GRCm39)	missense	probably damaging	1.00
IGL02234:Muc6	APN	7	141,226,842 (GRCm39)	missense	probably benign	0.09
IGL02302:Muc6	APN	7	141,227,763 (GRCm39)	missense	possibly damaging	0.53
IGL02331:Muc6	APN	7	141,226,726 (GRCm39)	missense	possibly damaging	0.53
IGL02531:Muc6	APN	7	141,216,853 (GRCm39)	missense	possibly damaging	0.53
IGL02639:Muc6	APN	7	141,235,843 (GRCm39)	splice site	probably benign
IGL02851:Muc6	APN	7	141,234,627 (GRCm39)	missense	probably damaging	1.00
IGL03026:Muc6	APN	7	141,226,414 (GRCm39)	intron	probably benign
IGL03070:Muc6	APN	7	141,230,834 (GRCm39)	splice site	probably benign
IGL03108:Muc6	APN	7	141,217,402 (GRCm39)	missense	possibly damaging	0.93
IGL03350:Muc6	APN	7	141,238,324 (GRCm39)	missense	probably damaging	1.00
IGL03366:Muc6	APN	7	141,234,349 (GRCm39)	missense	probably damaging	1.00
anticipation	UTSW	7	141,214,363 (GRCm39)	frame shift	probably null
F5770:Muc6	UTSW	7	141,233,880 (GRCm39)	missense	probably benign	0.11
IGL03147:Muc6	UTSW	7	141,218,313 (GRCm39)	missense	possibly damaging	0.95
R0001:Muc6	UTSW	7	141,227,841 (GRCm39)	missense	possibly damaging	0.53
R0005:Muc6	UTSW	7	141,218,685 (GRCm39)	missense	possibly damaging	0.72
R0147:Muc6	UTSW	7	141,238,255 (GRCm39)	missense	probably damaging	1.00
R0153:Muc6	UTSW	7	141,214,029 (GRCm39)	missense	possibly damaging	0.68
R0227:Muc6	UTSW	7	141,223,981 (GRCm39)	intron	probably benign
R0234:Muc6	UTSW	7	141,235,939 (GRCm39)	missense	possibly damaging	0.95
R0234:Muc6	UTSW	7	141,235,939 (GRCm39)	missense	possibly damaging	0.95
R0304:Muc6	UTSW	7	141,218,313 (GRCm39)	missense	possibly damaging	0.95
R0379:Muc6	UTSW	7	141,216,868 (GRCm39)	missense	possibly damaging	0.53
R0385:Muc6	UTSW	7	141,218,313 (GRCm39)	missense	possibly damaging	0.95
R0423:Muc6	UTSW	7	141,238,548 (GRCm39)	missense	probably benign	0.01
R0499:Muc6	UTSW	7	141,226,735 (GRCm39)	missense	probably benign
R0503:Muc6	UTSW	7	141,218,685 (GRCm39)	missense	possibly damaging	0.72
R0757:Muc6	UTSW	7	141,218,497 (GRCm39)	missense	probably benign	0.06
R0792:Muc6	UTSW	7	141,223,981 (GRCm39)	intron	probably benign
R0880:Muc6	UTSW	7	141,217,270 (GRCm39)	missense	possibly damaging	0.91
R1136:Muc6	UTSW	7	141,218,685 (GRCm39)	missense	possibly damaging	0.72
R1170:Muc6	UTSW	7	141,230,500 (GRCm39)	missense	probably damaging	0.99
R1174:Muc6	UTSW	7	141,234,368 (GRCm39)	missense	probably damaging	1.00
R1175:Muc6	UTSW	7	141,234,368 (GRCm39)	missense	probably damaging	1.00
R1189:Muc6	UTSW	7	141,232,122 (GRCm39)	missense	probably damaging	1.00
R1259:Muc6	UTSW	7	141,226,464 (GRCm39)	intron	probably benign
R1293:Muc6	UTSW	7	141,238,255 (GRCm39)	missense	probably damaging	1.00
R1295:Muc6	UTSW	7	141,238,144 (GRCm39)	missense	probably benign	0.04
R1296:Muc6	UTSW	7	141,238,144 (GRCm39)	missense	probably benign	0.04
R1471:Muc6	UTSW	7	141,234,176 (GRCm39)	missense	possibly damaging	0.61
R1472:Muc6	UTSW	7	141,238,144 (GRCm39)	missense	probably benign	0.04
R1548:Muc6	UTSW	7	141,218,685 (GRCm39)	missense	possibly damaging	0.72
R1548:Muc6	UTSW	7	141,238,368 (GRCm39)	splice site	probably benign
R1576:Muc6	UTSW	7	141,214,437 (GRCm39)	missense	possibly damaging	0.92
R1689:Muc6	UTSW	7	141,234,265 (GRCm39)	missense	probably damaging	1.00
R1702:Muc6	UTSW	7	141,236,752 (GRCm39)	missense	probably damaging	1.00
R1792:Muc6	UTSW	7	141,214,371 (GRCm39)	missense	probably benign	0.41
R1924:Muc6	UTSW	7	141,218,313 (GRCm39)	missense	possibly damaging	0.95
R1938:Muc6	UTSW	7	141,217,011 (GRCm39)	missense	probably damaging	0.99
R1964:Muc6	UTSW	7	141,226,330 (GRCm39)	intron	probably benign
R1964:Muc6	UTSW	7	141,226,329 (GRCm39)	nonsense	probably null
R1975:Muc6	UTSW	7	141,234,368 (GRCm39)	missense	probably damaging	1.00
R2031:Muc6	UTSW	7	141,218,313 (GRCm39)	missense	possibly damaging	0.95
R2104:Muc6	UTSW	7	141,213,991 (GRCm39)	missense	probably benign	0.23
R2201:Muc6	UTSW	7	141,236,075 (GRCm39)	missense	probably damaging	1.00
R2218:Muc6	UTSW	7	141,233,227 (GRCm39)	missense	probably benign	0.41
R2245:Muc6	UTSW	7	141,218,313 (GRCm39)	missense	possibly damaging	0.95
R2261:Muc6	UTSW	7	141,218,313 (GRCm39)	missense	possibly damaging	0.95
R2271:Muc6	UTSW	7	141,217,423 (GRCm39)	missense	possibly damaging	0.53
R2272:Muc6	UTSW	7	141,217,423 (GRCm39)	missense	possibly damaging	0.53
R2284:Muc6	UTSW	7	141,217,837 (GRCm39)	missense	possibly damaging	0.53
R2310:Muc6	UTSW	7	141,217,444 (GRCm39)	missense	possibly damaging	0.53
R2566:Muc6	UTSW	7	141,226,651 (GRCm39)	missense	possibly damaging	0.73
R2975:Muc6	UTSW	7	141,216,951 (GRCm39)	missense	possibly damaging	0.86
R3406:Muc6	UTSW	7	141,218,313 (GRCm39)	missense	possibly damaging	0.95
R3423:Muc6	UTSW	7	141,218,313 (GRCm39)	missense	possibly damaging	0.95
R3548:Muc6	UTSW	7	141,218,313 (GRCm39)	missense	possibly damaging	0.95
R3693:Muc6	UTSW	7	141,234,946 (GRCm39)	splice site	probably benign
R3872:Muc6	UTSW	7	141,226,867 (GRCm39)	missense	probably benign
R4029:Muc6	UTSW	7	141,218,313 (GRCm39)	missense	possibly damaging	0.95
R4084:Muc6	UTSW	7	141,234,920 (GRCm39)	missense	probably damaging	1.00
R4126:Muc6	UTSW	7	141,218,313 (GRCm39)	missense	possibly damaging	0.95
R4410:Muc6	UTSW	7	141,217,576 (GRCm39)	missense	possibly damaging	0.91
R4508:Muc6	UTSW	7	141,226,356 (GRCm39)	intron	probably benign
R4509:Muc6	UTSW	7	141,218,313 (GRCm39)	missense	possibly damaging	0.95
R4518:Muc6	UTSW	7	141,230,489 (GRCm39)	missense	probably benign	0.03
R4594:Muc6	UTSW	7	141,218,685 (GRCm39)	missense	possibly damaging	0.72
R4677:Muc6	UTSW	7	141,224,212 (GRCm39)	intron	probably benign
R4678:Muc6	UTSW	7	141,230,554 (GRCm39)	missense	probably benign	0.09
R4737:Muc6	UTSW	7	141,218,685 (GRCm39)	missense	possibly damaging	0.72
R4737:Muc6	UTSW	7	141,226,426 (GRCm39)	intron	probably benign
R4981:Muc6	UTSW	7	141,218,313 (GRCm39)	missense	possibly damaging	0.95
R5008:Muc6	UTSW	7	141,223,981 (GRCm39)	intron	probably benign
R5012:Muc6	UTSW	7	141,216,570 (GRCm39)	missense	possibly damaging	0.96
R5017:Muc6	UTSW	7	141,226,795 (GRCm39)	missense	probably benign
R5027:Muc6	UTSW	7	141,216,349 (GRCm39)	missense	probably benign	0.01
R5058:Muc6	UTSW	7	141,230,491 (GRCm39)	missense	probably benign	0.01
R5069:Muc6	UTSW	7	141,237,564 (GRCm39)	missense	probably damaging	1.00
R5126:Muc6	UTSW	7	141,237,564 (GRCm39)	missense	probably damaging	1.00
R5168:Muc6	UTSW	7	141,223,981 (GRCm39)	intron	probably benign
R5179:Muc6	UTSW	7	141,218,685 (GRCm39)	missense	possibly damaging	0.72
R5198:Muc6	UTSW	7	141,218,685 (GRCm39)	missense	possibly damaging	0.72
R5262:Muc6	UTSW	7	141,237,375 (GRCm39)	missense	possibly damaging	0.78
R5381:Muc6	UTSW	7	141,217,836 (GRCm39)	missense	possibly damaging	0.86
R5454:Muc6	UTSW	7	141,235,078 (GRCm39)	missense	possibly damaging	0.61
R5467:Muc6	UTSW	7	141,216,448 (GRCm39)	missense	possibly damaging	0.53
R5540:Muc6	UTSW	7	141,235,850 (GRCm39)	critical splice donor site	probably null
R5800:Muc6	UTSW	7	141,226,690 (GRCm39)	splice site	probably benign
R5808:Muc6	UTSW	7	141,226,360 (GRCm39)	intron	probably benign
R5865:Muc6	UTSW	7	141,236,769 (GRCm39)	missense	probably damaging	0.97
R5919:Muc6	UTSW	7	141,227,837 (GRCm39)	missense	possibly damaging	0.56
R6024:Muc6	UTSW	7	141,227,841 (GRCm39)	missense	possibly damaging	0.53
R6064:Muc6	UTSW	7	141,234,640 (GRCm39)	missense	probably damaging	1.00
R6126:Muc6	UTSW	7	141,218,685 (GRCm39)	missense	possibly damaging	0.72
R6229:Muc6	UTSW	7	141,226,792 (GRCm39)	missense	probably benign
R6236:Muc6	UTSW	7	141,218,685 (GRCm39)	missense	possibly damaging	0.72
R6245:Muc6	UTSW	7	141,235,086 (GRCm39)	missense	probably damaging	1.00
R6254:Muc6	UTSW	7	141,237,380 (GRCm39)	missense	probably benign	0.09
R6609:Muc6	UTSW	7	141,226,700 (GRCm39)	splice site	probably benign
R6610:Muc6	UTSW	7	141,226,700 (GRCm39)	splice site	probably benign
R6611:Muc6	UTSW	7	141,226,700 (GRCm39)	splice site	probably benign
R6623:Muc6	UTSW	7	141,223,981 (GRCm39)	intron	probably benign
R6626:Muc6	UTSW	7	141,223,981 (GRCm39)	intron	probably benign
R6817:Muc6	UTSW	7	141,237,326 (GRCm39)	missense	probably damaging	0.99
R6923:Muc6	UTSW	7	141,217,453 (GRCm39)	missense	possibly damaging	0.91
R6989:Muc6	UTSW	7	141,226,246 (GRCm39)	intron	probably benign
R7001:Muc6	UTSW	7	141,217,320 (GRCm39)	missense	probably damaging	0.99
R7046:Muc6	UTSW	7	141,226,456 (GRCm39)	intron	probably benign
R7097:Muc6	UTSW	7	141,214,363 (GRCm39)	frame shift	probably null
R7099:Muc6	UTSW	7	141,214,363 (GRCm39)	frame shift	probably null
R7101:Muc6	UTSW	7	141,214,363 (GRCm39)	frame shift	probably null
R7107:Muc6	UTSW	7	141,214,363 (GRCm39)	frame shift	probably null
R7108:Muc6	UTSW	7	141,214,363 (GRCm39)	frame shift	probably null
R7112:Muc6	UTSW	7	141,235,542 (GRCm39)	missense	probably damaging	1.00
R7202:Muc6	UTSW	7	141,214,363 (GRCm39)	frame shift	probably null
R7204:Muc6	UTSW	7	141,214,363 (GRCm39)	frame shift	probably null
R7205:Muc6	UTSW	7	141,214,363 (GRCm39)	frame shift	probably null
R7222:Muc6	UTSW	7	141,214,428 (GRCm39)	missense	unknown
R7230:Muc6	UTSW	7	141,235,479 (GRCm39)	missense	probably damaging	1.00
R7278:Muc6	UTSW	7	141,226,842 (GRCm39)	missense	probably benign	0.09
R7483:Muc6	UTSW	7	141,224,245 (GRCm39)	missense	unknown
R7501:Muc6	UTSW	7	141,217,659 (GRCm39)	missense	probably damaging	0.98
R7601:Muc6	UTSW	7	141,216,454 (GRCm39)	missense	unknown
R7641:Muc6	UTSW	7	141,224,247 (GRCm39)	missense	unknown
R7644:Muc6	UTSW	7	141,217,659 (GRCm39)	missense	probably damaging	0.98
R7645:Muc6	UTSW	7	141,234,923 (GRCm39)	missense	probably benign	0.40
R7659:Muc6	UTSW	7	141,216,973 (GRCm39)	missense	possibly damaging	0.53
R7674:Muc6	UTSW	7	141,224,247 (GRCm39)	missense	unknown
R7679:Muc6	UTSW	7	141,217,659 (GRCm39)	missense	probably damaging	0.98
R7680:Muc6	UTSW	7	141,217,659 (GRCm39)	missense	probably damaging	0.98
R7689:Muc6	UTSW	7	141,217,659 (GRCm39)	missense	probably damaging	0.98
R7690:Muc6	UTSW	7	141,217,659 (GRCm39)	missense	probably damaging	0.98
R7760:Muc6	UTSW	7	141,237,322 (GRCm39)	splice site	probably null
R7806:Muc6	UTSW	7	141,217,387 (GRCm39)	missense	possibly damaging	0.53
R7809:Muc6	UTSW	7	141,226,638 (GRCm39)	missense	probably benign	0.02
R7848:Muc6	UTSW	7	141,232,188 (GRCm39)	missense	possibly damaging	0.53
R7859:Muc6	UTSW	7	141,231,687 (GRCm39)	missense	probably damaging	0.96
R8054:Muc6	UTSW	7	141,231,748 (GRCm39)	missense	probably damaging	1.00
R8085:Muc6	UTSW	7	141,226,729 (GRCm39)	missense	unknown
R8130:Muc6	UTSW	7	141,233,354 (GRCm39)	missense	probably damaging	0.97
R8210:Muc6	UTSW	7	141,235,673 (GRCm39)	critical splice donor site	probably null
R8273:Muc6	UTSW	7	141,226,795 (GRCm39)	missense	unknown
R8294:Muc6	UTSW	7	141,217,263 (GRCm39)	missense	possibly damaging	0.96
R8329:Muc6	UTSW	7	141,226,525 (GRCm39)	missense	unknown
R8379:Muc6	UTSW	7	141,230,579 (GRCm39)	nonsense	probably null
R8537:Muc6	UTSW	7	141,234,184 (GRCm39)	missense	probably benign	0.03
R8736:Muc6	UTSW	7	141,228,439 (GRCm39)	missense	possibly damaging	0.53
R8767:Muc6	UTSW	7	141,229,549 (GRCm39)	missense	probably damaging	1.00
R8902:Muc6	UTSW	7	141,233,791 (GRCm39)	missense	possibly damaging	0.93
R9009:Muc6	UTSW	7	141,217,018 (GRCm39)	missense	possibly damaging	0.73
R9010:Muc6	UTSW	7	141,226,351 (GRCm39)	missense	unknown
R9023:Muc6	UTSW	7	141,237,432 (GRCm39)	nonsense	probably null
R9058:Muc6	UTSW	7	141,218,154 (GRCm39)	missense	possibly damaging	0.61
R9257:Muc6	UTSW	7	141,226,738 (GRCm39)	missense	unknown
R9495:Muc6	UTSW	7	141,237,398 (GRCm39)	missense	probably damaging	0.98
R9563:Muc6	UTSW	7	141,217,783 (GRCm39)	missense	possibly damaging	0.53
R9645:Muc6	UTSW	7	141,217,783 (GRCm39)	missense	possibly damaging	0.53
R9659:Muc6	UTSW	7	141,232,100 (GRCm39)	missense	probably damaging	1.00
R9733:Muc6	UTSW	7	141,216,310 (GRCm39)	missense	unknown
R9787:Muc6	UTSW	7	141,227,748 (GRCm39)	nonsense	probably null
R9788:Muc6	UTSW	7	141,232,100 (GRCm39)	missense	probably damaging	1.00
V7581:Muc6	UTSW	7	141,233,880 (GRCm39)	missense	probably benign	0.11
V7583:Muc6	UTSW	7	141,233,880 (GRCm39)	missense	probably benign	0.11
X0026:Muc6	UTSW	7	141,237,964 (GRCm39)	missense	possibly damaging	0.94
X0058:Muc6	UTSW	7	141,218,313 (GRCm39)	missense	possibly damaging	0.95
Z1177:Muc6	UTSW	7	141,237,656 (GRCm39)	missense	probably benign	0.20
Z1177:Muc6	UTSW	7	141,236,701 (GRCm39)	missense	probably benign	0.29
Z1177:Muc6	UTSW	7	141,217,827 (GRCm39)	missense	possibly damaging	0.72

Predicted Primers

PCR Primer
(F):5'- CCTGTCTGTGGAGAATGAGG -3'
(R):5'- ATGGGTCTAACTGGTACTCCAC -3'

Sequencing Primer
(F):5'- CCTGTCTGTGGAGAATGAGGTTTTG -3'
(R):5'- GGCACAACTAGCAGTCCTCAG -3'

Posted On

2018-11-09