Incidental Mutation 'R6817:Cmtm1'
ID540711
Institutional Source Beutler Lab
Gene Symbol Cmtm1
Ensembl Gene ENSMUSG00000110430
Gene NameCKLF-like MARVEL transmembrane domain containing 1
SynonymsCklfsf1, CHLFH1a, CKLFH1
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.455) question?
Stock #R6817 (G1)
Quality Score119.461
Status Not validated
Chromosome8
Chromosomal Location104292622-104310145 bp(-) (GRCm38)
Type of Mutationsmall deletion (11 aa in frame mutation)
DNA Base Change (assembly) CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT to CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT at 104309470 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000132828 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159039] [ENSMUST00000160596] [ENSMUST00000162616] [ENSMUST00000164175]
Predicted Effect probably benign
Transcript: ENSMUST00000159039
SMART Domains Protein: ENSMUSP00000124855
Gene: ENSMUSG00000110430

DomainStartEndE-ValueType
low complexity region 7 27 N/A INTRINSIC
internal_repeat_1 33 70 7.45e-12 PROSPERO
internal_repeat_2 34 74 9.92e-7 PROSPERO
internal_repeat_1 66 103 7.45e-12 PROSPERO
internal_repeat_2 122 162 9.92e-7 PROSPERO
transmembrane domain 190 212 N/A INTRINSIC
transmembrane domain 227 246 N/A INTRINSIC
transmembrane domain 253 275 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160596
SMART Domains Protein: ENSMUSP00000124656
Gene: ENSMUSG00000110430

DomainStartEndE-ValueType
low complexity region 7 27 N/A INTRINSIC
internal_repeat_1 33 70 1.42e-11 PROSPERO
internal_repeat_2 34 74 1.79e-6 PROSPERO
internal_repeat_1 66 103 1.42e-11 PROSPERO
internal_repeat_2 122 162 1.79e-6 PROSPERO
transmembrane domain 262 284 N/A INTRINSIC
transmembrane domain 289 311 N/A INTRINSIC
transmembrane domain 315 334 N/A INTRINSIC
transmembrane domain 341 363 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162616
SMART Domains Protein: ENSMUSP00000124800
Gene: ENSMUSG00000031876

DomainStartEndE-ValueType
low complexity region 7 27 N/A INTRINSIC
internal_repeat_1 33 70 1.42e-11 PROSPERO
internal_repeat_2 34 74 1.79e-6 PROSPERO
internal_repeat_1 66 103 1.42e-11 PROSPERO
internal_repeat_2 122 162 1.79e-6 PROSPERO
transmembrane domain 262 284 N/A INTRINSIC
transmembrane domain 289 311 N/A INTRINSIC
transmembrane domain 315 334 N/A INTRINSIC
transmembrane domain 341 363 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164175
SMART Domains Protein: ENSMUSP00000132828
Gene: ENSMUSG00000110430

DomainStartEndE-ValueType
low complexity region 7 27 N/A INTRINSIC
internal_repeat_1 34 71 1.23e-5 PROSPERO
internal_repeat_1 100 137 1.23e-5 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212847
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apeh G A 9: 108,092,679 H186Y probably damaging Het
Arhgap21 A C 2: 20,880,296 L690R probably benign Het
Asxl3 A G 18: 22,523,580 N1549S probably benign Het
Cast T C 13: 74,699,158 T670A possibly damaging Het
Cd109 A G 9: 78,714,955 D1409G probably benign Het
Cemip A G 7: 83,987,992 F311S probably damaging Het
Cfap43 T A 19: 47,756,085 I1210F possibly damaging Het
Cops5 G A 1: 10,030,604 L256F probably benign Het
Cux1 T C 5: 136,373,173 probably null Het
Dab1 A G 4: 104,679,546 K178E probably damaging Het
Ddc A G 11: 11,824,854 Y346H probably damaging Het
Dlg2 T G 7: 91,965,664 D225E probably benign Het
Dsg1b A T 18: 20,394,405 I198F probably damaging Het
Ect2l T C 10: 18,174,059 H155R probably benign Het
Epha2 A G 4: 141,308,994 H247R probably damaging Het
Esrp1 A G 4: 11,357,552 V355A probably damaging Het
Fam78b A G 1: 167,078,850 M193V possibly damaging Het
Gdpd4 A G 7: 97,957,830 T4A probably benign Het
Gm17175 T C 14: 51,573,021 N50D possibly damaging Het
Kcnt2 A G 1: 140,246,193 probably benign Het
Lpo T C 11: 87,809,241 N525D probably benign Het
Lrrc41 G A 4: 116,089,305 E406K possibly damaging Het
Lrrc59 G C 11: 94,630,065 D21H probably damaging Het
Mgat4a G A 1: 37,449,123 R472* probably null Het
Mroh7 C T 4: 106,714,115 A14T probably benign Het
Muc5b T C 7: 141,862,913 S3199P probably benign Het
Muc6 T A 7: 141,651,061 Y270F probably damaging Het
Myo18b T A 5: 112,830,238 T1273S probably benign Het
Nos2 A T 11: 78,945,266 E385V possibly damaging Het
Nsl1 T G 1: 191,063,274 probably null Het
Nup93 T C 8: 94,314,682 probably null Het
Olfr1175-ps A T 2: 88,322,763 M314K probably benign Het
Pcna-ps2 T G 19: 9,283,497 M40R probably damaging Het
Pik3r5 A G 11: 68,486,581 E148G probably damaging Het
Pirt A G 11: 66,925,911 E16G probably damaging Het
Pkp4 T C 2: 59,318,600 Y566H probably damaging Het
Psg17 A C 7: 18,814,640 V402G probably damaging Het
Ptprb GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT 10: 116,283,677 Het
Rassf7 A G 7: 141,217,447 E191G probably damaging Het
Rnf213 T C 11: 119,462,285 probably null Het
Slc34a2 C T 5: 53,064,028 T272I probably damaging Het
Sos2 T C 12: 69,618,161 E332G probably benign Het
Spdye4c T C 2: 128,596,510 Y263H probably damaging Het
Tmprss11f C T 5: 86,556,934 V42I probably benign Het
Trpv5 T A 6: 41,658,007 N463Y possibly damaging Het
Ush2a A T 1: 188,862,864 Q3831L probably benign Het
Wdr41 C A 13: 94,997,304 probably null Het
Zfand1 A G 3: 10,340,824 C246R probably benign Het
Other mutations in Cmtm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
Senilicus UTSW 8 104309295 missense possibly damaging 0.90
R2900:Cmtm1 UTSW 8 104309544 missense possibly damaging 0.95
R4132:Cmtm1 UTSW 8 104309470 small deletion probably benign
R4615:Cmtm1 UTSW 8 104309470 small deletion probably benign
R4723:Cmtm1 UTSW 8 104293675 missense probably damaging 0.96
R5277:Cmtm1 UTSW 8 104309470 small deletion probably benign
R5347:Cmtm1 UTSW 8 104309470 small deletion probably benign
R5364:Cmtm1 UTSW 8 104309470 small deletion probably benign
R5394:Cmtm1 UTSW 8 104309470 small deletion probably benign
R5403:Cmtm1 UTSW 8 104309470 small deletion probably benign
R5611:Cmtm1 UTSW 8 104309470 small deletion probably benign
R5715:Cmtm1 UTSW 8 104309470 small deletion probably benign
R5731:Cmtm1 UTSW 8 104309470 small deletion probably benign
R5773:Cmtm1 UTSW 8 104305176 missense probably damaging 1.00
R6017:Cmtm1 UTSW 8 104310951 unclassified probably benign
R6207:Cmtm1 UTSW 8 104309470 small deletion probably benign
R6313:Cmtm1 UTSW 8 104305163 missense possibly damaging 0.81
R6528:Cmtm1 UTSW 8 104309295 missense possibly damaging 0.90
R6821:Cmtm1 UTSW 8 104309702
R6822:Cmtm1 UTSW 8 104309702
Predicted Primers PCR Primer
(F):5'- AACATCCCATTGGCTGAGCAG -3'
(R):5'- TATACCATCCAGGCAGCGAC -3'

Sequencing Primer
(F):5'- TGCCAGAAGCTATCTCTGAATC -3'
(R):5'- GGCAGCGACCTTCAGTACAAG -3'
Posted On2018-11-16