Incidental Mutation 'R6822:Cmtm1'
ID540724
Institutional Source Beutler Lab
Gene Symbol Cmtm1
Ensembl Gene ENSMUSG00000110430
Gene NameCKLF-like MARVEL transmembrane domain containing 1
SynonymsCklfsf1, CHLFH1a, CKLFH1
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.455) question?
Stock #R6822 (G1)
Quality Score168.466
Status Not validated
Chromosome8
Chromosomal Location104292622-104310145 bp(-) (GRCm38)
Type of Mutation
DNA Base Change (assembly) TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG to TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG at 104309702 bp
ZygosityHeterozygous
Amino Acid Change
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam11 G A 11: 102,776,675 R687Q possibly damaging Het
AI987944 A G 7: 41,374,808 L249P probably damaging Het
Ankrd28 T A 14: 31,736,840 probably null Het
Bahcc1 T C 11: 120,287,721 S2369P probably damaging Het
Birc6 T C 17: 74,580,382 S902P possibly damaging Het
Birc6 A T 17: 74,598,044 K1277N probably damaging Het
Brwd1 T C 16: 96,041,274 E821G probably benign Het
Cct8l1 T C 5: 25,517,939 S551P possibly damaging Het
Cyp2c39 A T 19: 39,536,817 D188V probably damaging Het
Dclk3 G T 9: 111,439,337 A25S probably benign Het
Dpep2 A T 8: 105,985,241 M518K probably benign Het
Dst T C 1: 34,275,674 V6462A probably damaging Het
Entpd3 T C 9: 120,562,038 probably null Het
Epm2aip1 T C 9: 111,272,556 V199A probably damaging Het
Fam193b A G 13: 55,541,691 probably benign Het
Fam50b G A 13: 34,747,101 E187K possibly damaging Het
Fat1 A G 8: 45,026,404 D2829G probably damaging Het
Fcgbp T A 7: 28,107,356 Y2250N probably damaging Het
Gm40460 ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,713 Het
Grik5 C T 7: 25,046,355 R431Q possibly damaging Het
H2-Aa C T 17: 34,287,677 probably null Het
Igsf9 T A 1: 172,497,163 S883T possibly damaging Het
Kcnh7 T G 2: 62,787,904 I414L probably damaging Het
Kcnma1 T C 14: 24,003,744 probably null Het
Kcnmb1 T C 11: 33,964,686 probably benign Het
Kmt2d A G 15: 98,849,459 probably benign Het
Krt9 TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC 11: 100,189,077 Het
Map3k13 G A 16: 21,922,263 S780N probably benign Het
Nlgn1 T C 3: 26,133,647 T30A probably benign Het
Nucb1 A G 7: 45,498,865 F175L probably damaging Het
Pax6 T A 2: 105,685,923 V182E probably benign Het
Ptger1 A G 8: 83,668,650 D252G probably benign Het
Rexo4 T C 2: 26,960,271 D275G probably damaging Het
Ripk4 T C 16: 97,746,036 D342G probably damaging Het
Rpl10l A T 12: 66,284,213 C49S possibly damaging Het
Sema7a T C 9: 57,960,336 F457S probably damaging Het
Shank3 G A 15: 89,531,627 D155N probably damaging Het
Smpd3 G A 8: 106,265,964 probably benign Het
Smpd4 T C 16: 17,640,233 V465A probably damaging Het
Sohlh2 T C 3: 55,207,686 V364A probably damaging Het
Sos2 C T 12: 69,650,649 R99Q probably damaging Het
Spry2 G A 14: 105,893,357 Q132* probably null Het
Tbx19 G T 1: 165,140,140 P346Q probably damaging Het
Tdrd6 A G 17: 43,627,215 Y981H probably damaging Het
Tinag T C 9: 77,031,702 K165E probably benign Het
Tubb4a A T 17: 57,080,904 I374N probably damaging Het
Umodl1 C T 17: 30,986,554 Q708* probably null Het
Vmn2r3 A T 3: 64,287,455 V14E probably benign Het
Zfp82 G A 7: 30,056,287 L457F probably damaging Het
Other mutations in Cmtm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
Senilicus UTSW 8 104309295 missense possibly damaging 0.90
R2900:Cmtm1 UTSW 8 104309544 missense possibly damaging 0.95
R4132:Cmtm1 UTSW 8 104309470 small deletion probably benign
R4615:Cmtm1 UTSW 8 104309470 small deletion probably benign
R4723:Cmtm1 UTSW 8 104293675 missense probably damaging 0.96
R5277:Cmtm1 UTSW 8 104309470 small deletion probably benign
R5347:Cmtm1 UTSW 8 104309470 small deletion probably benign
R5364:Cmtm1 UTSW 8 104309470 small deletion probably benign
R5394:Cmtm1 UTSW 8 104309470 small deletion probably benign
R5403:Cmtm1 UTSW 8 104309470 small deletion probably benign
R5611:Cmtm1 UTSW 8 104309470 small deletion probably benign
R5715:Cmtm1 UTSW 8 104309470 small deletion probably benign
R5731:Cmtm1 UTSW 8 104309470 small deletion probably benign
R5773:Cmtm1 UTSW 8 104305176 missense probably damaging 1.00
R6017:Cmtm1 UTSW 8 104310951 unclassified probably benign
R6207:Cmtm1 UTSW 8 104309470 small deletion probably benign
R6313:Cmtm1 UTSW 8 104305163 missense possibly damaging 0.81
R6528:Cmtm1 UTSW 8 104309295 missense possibly damaging 0.90
R6817:Cmtm1 UTSW 8 104309470 small deletion probably benign
R6821:Cmtm1 UTSW 8 104309702
Predicted Primers PCR Primer
(F):5'- TGTGGCACGTACTGAAGGTC -3'
(R):5'- GCTTAACTTTACGACCTCGAGTG -3'

Sequencing Primer
(F):5'- ACGTACTGAAGGTCGCTGACTG -3'
(R):5'- ACCTTCGGATTCACAGGCGTATG -3'
Posted On2018-11-16