Incidental Mutation 'R6419:Ntng1'
ID540738
Institutional Source Beutler Lab
Gene Symbol Ntng1
Ensembl Gene ENSMUSG00000059857
Gene Namenetrin G1
SynonymsLmnt1, A930010C08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6419 (G1)
Quality Score70.0074
Status Validated
Chromosome3
Chromosomal Location109780040-110144011 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 109782853 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 424 (N424K)
Ref Sequence ENSEMBL: ENSMUSP00000116213 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072596] [ENSMUST00000106570] [ENSMUST00000106571] [ENSMUST00000106575] [ENSMUST00000131027] [ENSMUST00000133268] [ENSMUST00000138344] [ENSMUST00000138953] [ENSMUST00000156177]
Predicted Effect possibly damaging
Transcript: ENSMUST00000072596
AA Change: N483K

PolyPhen 2 Score 0.830 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000072397
Gene: ENSMUSG00000059857
AA Change: N483K

DomainStartEndE-ValueType
LamNT 59 295 3.22e-18 SMART
EGF_Lam 297 354 6.86e-4 SMART
EGF_Lam 364 417 4.81e-8 SMART
EGF_Lam 420 462 5.74e-6 SMART
EGF 466 498 5.12e-3 SMART
low complexity region 522 537 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000106570
AA Change: N405K

PolyPhen 2 Score 0.759 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000102180
Gene: ENSMUSG00000059857
AA Change: N405K

DomainStartEndE-ValueType
LamNT 59 295 3.22e-18 SMART
EGF_Lam 297 355 1.28e-3 SMART
EGF 388 420 5.12e-3 SMART
low complexity region 444 459 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000106571
AA Change: N425K

PolyPhen 2 Score 0.919 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000102181
Gene: ENSMUSG00000059857
AA Change: N425K

DomainStartEndE-ValueType
LamNT 59 295 3.22e-18 SMART
EGF_Lam 297 354 6.86e-4 SMART
EGF 408 440 5.12e-3 SMART
low complexity region 464 479 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000106575
AA Change: N483K

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000102185
Gene: ENSMUSG00000059857
AA Change: N483K

DomainStartEndE-ValueType
LamNT 59 295 3.22e-18 SMART
EGF_Lam 297 355 3.33e-2 SMART
EGF_Lam 364 417 4.81e-8 SMART
EGF_Lam 420 462 5.74e-6 SMART
EGF 466 498 5.12e-3 SMART
low complexity region 522 537 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000131027
AA Change: N438K

PolyPhen 2 Score 0.913 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000118800
Gene: ENSMUSG00000059857
AA Change: N438K

DomainStartEndE-ValueType
LamNT 59 295 3.22e-18 SMART
EGF_Lam 297 354 6.86e-4 SMART
EGF_Lam 364 417 4.81e-8 SMART
EGF 421 453 5.12e-3 SMART
low complexity region 477 492 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000133268
AA Change: N382K

PolyPhen 2 Score 0.425 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000117371
Gene: ENSMUSG00000059857
AA Change: N382K

DomainStartEndE-ValueType
LamNT 59 295 3.22e-18 SMART
EGF_Lam 297 354 6.86e-4 SMART
EGF 365 397 5.12e-3 SMART
low complexity region 421 436 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000138344
AA Change: N427K

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000120688
Gene: ENSMUSG00000059857
AA Change: N427K

DomainStartEndE-ValueType
LamNT 59 295 3.22e-18 SMART
EGF_Lam 297 354 6.86e-4 SMART
EGF_Lam 364 406 5.74e-6 SMART
EGF 410 442 5.12e-3 SMART
low complexity region 466 481 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000138953
AA Change: N424K

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000116213
Gene: ENSMUSG00000059857
AA Change: N424K

DomainStartEndE-ValueType
LamNT 59 295 3.22e-18 SMART
EGF_Lam 297 354 6.86e-4 SMART
EGF 407 439 5.12e-3 SMART
low complexity region 463 478 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000156177
AA Change: N404K

PolyPhen 2 Score 0.924 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000119534
Gene: ENSMUSG00000059857
AA Change: N404K

DomainStartEndE-ValueType
LamNT 59 295 3.22e-18 SMART
EGF_Lam 297 354 6.86e-4 SMART
EGF 387 419 5.12e-3 SMART
low complexity region 443 458 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.3%
Validation Efficiency 96% (67/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a preproprotein that is processed into a secreted protein containing eukaroytic growth factor (EGF)-like domains. This protein acts to guide axon growth during neuronal development. Polymorphisms in this gene may be associated with schizophrenia. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a null allele survive into adulthood with no major alterations in gross brain cytoarchitecture or axonal projection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578G10Rik T C 4: 42,812,473 probably benign Het
Abcc2 T A 19: 43,837,508 probably null Het
Adamts12 C T 15: 11,215,673 T260M possibly damaging Het
Adamts20 C T 15: 94,333,675 V878I possibly damaging Het
Adgrl4 A G 3: 151,439,316 E34G probably damaging Het
Asah1 A T 8: 41,343,766 I293N probably damaging Het
B3galt2 A T 1: 143,647,101 E325V possibly damaging Het
Baz1b T A 5: 135,242,494 H1310Q probably benign Het
Ccdc125 T A 13: 100,690,326 N204K probably damaging Het
Cd36 C T 5: 17,797,152 D284N probably benign Het
Cdh12 T C 15: 21,520,397 L316S probably damaging Het
Cenpv T C 11: 62,525,182 K247R probably benign Het
Cldn18 T C 9: 99,692,748 H257R possibly damaging Het
Cnot8 T A 11: 58,114,065 Y197N probably damaging Het
Cog3 A T 14: 75,724,738 C554* probably null Het
Col4a4 A G 1: 82,466,486 probably null Het
Cops5 G A 1: 10,033,307 T158I probably damaging Het
Dhh A G 15: 98,894,401 F242S probably damaging Het
Dot1l T C 10: 80,791,481 V1512A possibly damaging Het
Dstn T G 2: 143,939,987 I116S possibly damaging Het
Egfem1 G A 3: 29,657,249 D326N probably damaging Het
Enpp3 A T 10: 24,808,191 Y52N probably damaging Het
Fam214a G A 9: 75,009,337 S413N probably benign Het
Gabra2 A G 5: 70,962,083 S359P probably benign Het
Gbp7 G A 3: 142,546,453 G599E probably benign Het
Gcat T G 15: 79,036,064 I198S probably damaging Het
Gm8439 A G 4: 120,609,558 K82R unknown Het
Grin2b A G 6: 135,740,967 F709S probably damaging Het
Grm3 T C 5: 9,570,201 N348D probably damaging Het
Hdgfl1 G A 13: 26,770,092 probably benign Het
Hmgxb3 G T 18: 61,152,224 D564E possibly damaging Het
Igkv4-61 C A 6: 69,417,154 A31S possibly damaging Het
Impg1 A G 9: 80,380,018 V305A probably benign Het
Ints7 T A 1: 191,602,302 S313T possibly damaging Het
Knl1 T A 2: 119,069,003 I395K probably benign Het
Lactb2 A T 1: 13,638,235 Y196* probably null Het
Lad1 T C 1: 135,831,892 S509P possibly damaging Het
Ltf T C 9: 111,031,022 F504L possibly damaging Het
Med4 A T 14: 73,513,923 D104V probably damaging Het
Mrpl58 A T 11: 115,410,247 N128Y probably damaging Het
Ndufs2 T C 1: 171,241,099 T54A probably benign Het
Notch2 G T 3: 98,100,389 probably null Het
Ntrk2 G A 13: 58,861,299 W301* probably null Het
Olfr1471 T A 19: 13,445,767 S252T probably benign Het
Otud6b A G 4: 14,822,766 S113P possibly damaging Het
Papd7 A C 13: 69,510,666 M350R possibly damaging Het
Pcdhb20 A G 18: 37,505,555 N378S probably damaging Het
Polr3b T C 10: 84,638,111 S185P possibly damaging Het
Ptprn G A 1: 75,264,037 R31C probably benign Het
Rgsl1 C T 1: 153,822,371 V478M probably damaging Het
Sema6b A T 17: 56,132,784 L19* probably null Het
Slfn8 A G 11: 83,004,055 probably null Het
Spen A T 4: 141,476,310 S1669T unknown Het
Syne2 T C 12: 76,096,966 F1522L probably damaging Het
Tarbp1 C T 8: 126,459,044 A470T possibly damaging Het
Tiam1 C A 16: 89,898,024 E182* probably null Het
Tmem231 G A 8: 111,926,892 probably benign Het
Trip12 C T 1: 84,793,870 A186T probably damaging Het
Ufc1 C T 1: 171,288,956 A147T probably damaging Het
Vmn1r199 A G 13: 22,383,607 K314R possibly damaging Het
Vmn2r13 A T 5: 109,175,219 I68K possibly damaging Het
Vmn2r77 A T 7: 86,811,559 I698F probably damaging Het
Vmn2r86 T C 10: 130,446,926 K607R probably damaging Het
Vwa3b T C 1: 37,157,376 V28A probably benign Het
Wdr19 A G 5: 65,215,893 N166S possibly damaging Het
Wfdc17 G A 11: 83,704,808 G33R probably damaging Het
Zfp330 T G 8: 82,764,916 K209N probably benign Het
Zfp493 A G 13: 67,786,407 T160A probably benign Het
Zfp974 A T 7: 27,911,515 C262S possibly damaging Het
Other mutations in Ntng1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02162:Ntng1 APN 3 109934995 nonsense probably null
IGL02367:Ntng1 APN 3 110135513 unclassified probably null
IGL02448:Ntng1 APN 3 109934559 splice site probably benign
IGL02487:Ntng1 APN 3 109935047 missense probably damaging 0.98
IGL02500:Ntng1 APN 3 110135330 missense probably damaging 1.00
IGL02578:Ntng1 APN 3 110135394 missense probably benign 0.01
IGL03009:Ntng1 APN 3 109934702 missense possibly damaging 0.89
IGL03096:Ntng1 APN 3 110135349 missense probably benign 0.19
R0108:Ntng1 UTSW 3 109851755 splice site probably benign
R0326:Ntng1 UTSW 3 110135503 nonsense probably null
R0403:Ntng1 UTSW 3 109934611 missense probably damaging 0.97
R0699:Ntng1 UTSW 3 109872295 missense probably damaging 1.00
R0702:Ntng1 UTSW 3 109872254 missense probably damaging 1.00
R1981:Ntng1 UTSW 3 109935010 missense possibly damaging 0.61
R2096:Ntng1 UTSW 3 109832555 missense probably damaging 0.99
R3739:Ntng1 UTSW 3 109934691 missense probably damaging 1.00
R3963:Ntng1 UTSW 3 109934868 missense probably damaging 1.00
R4484:Ntng1 UTSW 3 110143808 unclassified probably benign
R4516:Ntng1 UTSW 3 109935013 missense probably damaging 1.00
R4518:Ntng1 UTSW 3 109935013 missense probably damaging 1.00
R4520:Ntng1 UTSW 3 109934996 missense probably damaging 1.00
R4523:Ntng1 UTSW 3 109934996 missense probably damaging 1.00
R4524:Ntng1 UTSW 3 109934996 missense probably damaging 1.00
R4776:Ntng1 UTSW 3 109934713 missense probably damaging 1.00
R4817:Ntng1 UTSW 3 109934868 missense probably damaging 1.00
R4827:Ntng1 UTSW 3 110135411 missense probably damaging 1.00
R4990:Ntng1 UTSW 3 110135261 critical splice donor site probably null
R5067:Ntng1 UTSW 3 110135345 missense possibly damaging 0.95
R5087:Ntng1 UTSW 3 110135329 nonsense probably null
R5196:Ntng1 UTSW 3 109934983 missense probably damaging 1.00
R5263:Ntng1 UTSW 3 109934872 missense probably damaging 0.99
R5743:Ntng1 UTSW 3 110135420 missense probably damaging 1.00
R6268:Ntng1 UTSW 3 109935035 missense probably damaging 1.00
R6292:Ntng1 UTSW 3 110143886 unclassified probably benign
R6898:Ntng1 UTSW 3 109872218 missense probably damaging 0.98
R7081:Ntng1 UTSW 3 109851789 missense probably benign 0.00
R7090:Ntng1 UTSW 3 109935180 nonsense probably null
R7134:Ntng1 UTSW 3 109935129 missense probably benign
R7302:Ntng1 UTSW 3 109832617 missense possibly damaging 0.94
R7353:Ntng1 UTSW 3 110135447 missense probably damaging 1.00
R7408:Ntng1 UTSW 3 109853082 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGTGACCCCTAGAACACCAG -3'
(R):5'- GCAGCCGACTACATTTGTTTGG -3'

Sequencing Primer
(F):5'- CCCTAGAACACCAGGGGAC -3'
(R):5'- TTGGAAATTGGAGTCACATGC -3'
Posted On2018-11-21