Incidental Mutation 'R6944:Dnah1'
ID540800
Institutional Source Beutler Lab
Gene Symbol Dnah1
Ensembl Gene ENSMUSG00000019027
Gene Namedynein, axonemal, heavy chain 1
SynonymsE030034C22Rik, MDHC7, Dnahc1, B230373P09Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6944 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location31260375-31323896 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 31268904 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 3153 (Y3153H)
Ref Sequence ENSEMBL: ENSMUSP00000043281 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048603]
Predicted Effect probably damaging
Transcript: ENSMUST00000048603
AA Change: Y3153H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000043281
Gene: ENSMUSG00000019027
AA Change: Y3153H

DomainStartEndE-ValueType
low complexity region 43 59 N/A INTRINSIC
Pfam:DHC_N2 998 1404 6.3e-146 PFAM
AAA 1558 1697 6.02e-1 SMART
AAA 1839 2077 4.66e0 SMART
low complexity region 2149 2157 N/A INTRINSIC
AAA 2204 2353 2.35e-1 SMART
Pfam:AAA_8 2533 2803 7.7e-84 PFAM
Pfam:MT 2815 3165 9.9e-57 PFAM
Pfam:AAA_9 3185 3410 1.1e-93 PFAM
Pfam:Dynein_heavy 3545 4246 2.7e-275 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an inner dynein arm heavy chain that provides structural support between the radial spokes and the outer doublet of the sperm tail. Naturally occurring mutations in this gene are associated with primary ciliary dyskinesia and multiple morphological anomalies of the flagella that result in asthenozoospermia and male infertility. Mice with a homozygous knockout of the orthologous gene are viable but have reduced sperm motility and are infertile. [provided by RefSeq, Feb 2017]
PHENOTYPE: Homozygous mutants are male sterile, and show impaired ciliary and flagellar motility that is also observed in the tracheal cilia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A C 10: 82,296,222 I318R probably benign Het
Abcb1b T G 5: 8,813,693 V216G probably damaging Het
Abcb5 T C 12: 118,911,530 R636G probably benign Het
Ago1 G T 4: 126,460,422 F198L possibly damaging Het
Ankrd42 C T 7: 92,619,547 probably null Het
Anxa11 T A 14: 25,874,752 F274I probably damaging Het
Ascc1 T C 10: 60,013,653 L122P probably damaging Het
Bptf T C 11: 107,080,823 S953G probably damaging Het
Chml T A 1: 175,688,161 N65Y probably damaging Het
Clcc1 A G 3: 108,670,968 K262E probably damaging Het
Clhc1 T G 11: 29,569,346 D384E probably damaging Het
Cntnap1 T C 11: 101,182,904 V627A probably damaging Het
Col6a4 A G 9: 106,072,171 V755A probably damaging Het
Cyp4f18 T A 8: 71,989,894 I406F probably benign Het
Dclre1a T C 19: 56,545,019 E381G possibly damaging Het
Dnah8 C A 17: 30,794,659 D3791E probably benign Het
Dnah9 T C 11: 66,085,149 E1358G possibly damaging Het
Eef1g G A 19: 8,968,292 R30H probably benign Het
Egln3 A T 12: 54,183,952 I181N probably benign Het
Entpd6 A G 2: 150,763,599 T250A probably damaging Het
Epb41l5 C T 1: 119,609,129 R344Q probably damaging Het
Fam20b T C 1: 156,687,521 D258G probably benign Het
Fbxw18 A T 9: 109,702,587 D21E probably damaging Het
Fbxw21 T C 9: 109,157,535 E92G probably damaging Het
Fzd6 T A 15: 39,025,817 M110K possibly damaging Het
Gm4070 G A 7: 105,901,980 Q622* probably null Het
Gm9268 T C 7: 43,047,969 F817L possibly damaging Het
Golgb1 C T 16: 36,912,113 P574L probably benign Het
Gpr153 A G 4: 152,279,363 E80G probably damaging Het
Kcnt1 T C 2: 25,877,828 probably benign Het
Kcnt2 T G 1: 140,584,065 V962G probably benign Het
Malt1 T C 18: 65,437,920 V109A probably benign Het
March7 A G 2: 60,234,243 I288V probably benign Het
Mief1 C T 15: 80,249,443 R234C probably damaging Het
Morc3 A G 16: 93,870,572 S613G probably benign Het
Myt1 A G 2: 181,797,594 E345G possibly damaging Het
Napb T C 2: 148,706,969 T133A probably benign Het
Nwd1 T C 8: 72,653,534 V16A possibly damaging Het
Oas1f G A 5: 120,848,184 E67K probably benign Het
Obscn T C 11: 59,038,930 K5153R probably damaging Het
Olfr1441 G T 19: 12,423,264 M318I probably benign Het
Olfr154 C T 2: 85,663,851 M194I probably benign Het
Olfr212 T C 6: 116,515,830 F18L possibly damaging Het
Olfr317 T A 11: 58,732,242 S308C possibly damaging Het
Pdcd2 T C 17: 15,525,370 N185S possibly damaging Het
Pgap1 A T 1: 54,530,161 W349R probably damaging Het
Prpf39 T A 12: 65,042,680 V64E probably benign Het
Ptpn13 T A 5: 103,476,991 W54R probably null Het
Rbms3 G T 9: 117,110,105 P29Q probably damaging Het
Rnf123 A G 9: 108,063,623 L679P probably benign Het
Samd4 T A 14: 47,016,635 D84E possibly damaging Het
Scarf1 T C 11: 75,522,206 V426A probably benign Het
Slc12a1 A G 2: 125,160,534 N145D probably damaging Het
Slc2a6 A T 2: 27,026,064 M99K probably damaging Het
Slc34a2 A T 5: 53,064,883 I306L probably benign Het
Slx4ip A G 2: 137,068,275 K397E probably damaging Het
Smr3a C T 5: 88,008,090 probably benign Het
Spef2 T C 15: 9,592,749 E1502G probably damaging Het
Sri A T 5: 8,063,365 T119S probably benign Het
Synrg T A 11: 84,025,086 L1085H probably damaging Het
Taf7 A T 18: 37,642,857 L219H probably damaging Het
Tmco3 T A 8: 13,303,729 V347E probably damaging Het
Tmem8b A T 4: 43,674,465 I250F probably damaging Het
Tom1l2 A G 11: 60,248,991 V239A probably damaging Het
Trpm1 T A 7: 64,243,433 M1011K probably damaging Het
Tspan9 A T 6: 127,965,806 Y153N probably benign Het
Ttll11 T C 2: 35,752,294 H675R probably benign Het
Unc50 C T 1: 37,432,662 T131M probably damaging Het
Vgf T A 5: 137,032,352 I456N probably damaging Het
Vmn1r223 A G 13: 23,249,313 I26V unknown Het
Vmn1r39 T C 6: 66,805,221 M1V probably null Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r14 T C 5: 109,216,059 T664A probably benign Het
Vmn2r14 G A 5: 109,216,274 T592I probably benign Het
Vmn2r96 T A 17: 18,597,629 F489L probably benign Het
Other mutations in Dnah1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Dnah1 APN 14 31287873 missense probably benign 0.01
IGL00227:Dnah1 APN 14 31286896 missense probably damaging 1.00
IGL00491:Dnah1 APN 14 31261839 missense probably damaging 1.00
IGL00787:Dnah1 APN 14 31300063 missense possibly damaging 0.91
IGL00809:Dnah1 APN 14 31300809 nonsense probably null
IGL00911:Dnah1 APN 14 31304434 splice site probably null
IGL00949:Dnah1 APN 14 31307090 missense probably benign 0.00
IGL00976:Dnah1 APN 14 31278138 missense probably damaging 1.00
IGL01484:Dnah1 APN 14 31299940 missense probably damaging 0.98
IGL01629:Dnah1 APN 14 31292320 missense probably damaging 1.00
IGL01716:Dnah1 APN 14 31263378 missense probably benign 0.34
IGL01893:Dnah1 APN 14 31266470 missense probably damaging 1.00
IGL01933:Dnah1 APN 14 31310915 missense probably benign 0.40
IGL01938:Dnah1 APN 14 31283887 missense probably benign
IGL02032:Dnah1 APN 14 31274369 missense probably benign
IGL02052:Dnah1 APN 14 31268786 missense probably damaging 0.99
IGL02097:Dnah1 APN 14 31305001 missense possibly damaging 0.92
IGL02127:Dnah1 APN 14 31304928 missense probably benign 0.00
IGL02143:Dnah1 APN 14 31283289 missense probably damaging 1.00
IGL02158:Dnah1 APN 14 31300967 missense probably benign 0.00
IGL02442:Dnah1 APN 14 31287878 missense probably damaging 1.00
IGL02525:Dnah1 APN 14 31305833 missense probably benign 0.05
IGL02558:Dnah1 APN 14 31274379 missense possibly damaging 0.96
IGL02633:Dnah1 APN 14 31284815 missense probably benign 0.05
IGL02720:Dnah1 APN 14 31262220 missense probably damaging 0.96
IGL02728:Dnah1 APN 14 31283998 missense probably benign 0.44
IGL02738:Dnah1 APN 14 31292640 missense probably benign 0.27
IGL02863:Dnah1 APN 14 31295293 missense probably damaging 0.99
IGL02944:Dnah1 APN 14 31300871 missense possibly damaging 0.88
IGL03110:Dnah1 APN 14 31266717 missense probably benign 0.40
IGL03201:Dnah1 APN 14 31300949 missense probably benign 0.13
IGL03215:Dnah1 APN 14 31274391 missense probably damaging 1.00
IGL03230:Dnah1 APN 14 31270066 missense probably damaging 1.00
IGL03248:Dnah1 APN 14 31269889 missense probably damaging 1.00
IGL03267:Dnah1 APN 14 31286588 missense probably benign 0.00
IGL03299:Dnah1 APN 14 31315122 nonsense probably null
IGL03301:Dnah1 APN 14 31292692 missense probably damaging 1.00
ergonomic UTSW 14 31300748 missense possibly damaging 0.91
faraday UTSW 14 31310882 missense probably null 0.05
K3955:Dnah1 UTSW 14 31266459 missense probably benign
PIT1430001:Dnah1 UTSW 14 31262580 missense probably damaging 1.00
PIT4382001:Dnah1 UTSW 14 31284455 missense probably damaging 1.00
R0043:Dnah1 UTSW 14 31274405 missense probably damaging 0.97
R0092:Dnah1 UTSW 14 31271609 missense probably benign 0.00
R0100:Dnah1 UTSW 14 31262152 critical splice donor site probably null
R0100:Dnah1 UTSW 14 31262152 critical splice donor site probably null
R0101:Dnah1 UTSW 14 31283899 missense probably damaging 1.00
R0119:Dnah1 UTSW 14 31276158 missense probably damaging 1.00
R0136:Dnah1 UTSW 14 31276158 missense probably damaging 1.00
R0144:Dnah1 UTSW 14 31267874 splice site probably benign
R0279:Dnah1 UTSW 14 31302375 missense possibly damaging 0.94
R0299:Dnah1 UTSW 14 31276158 missense probably damaging 1.00
R0316:Dnah1 UTSW 14 31278151 missense probably benign 0.00
R0739:Dnah1 UTSW 14 31265915 nonsense probably null
R0789:Dnah1 UTSW 14 31304591 missense probably benign
R0826:Dnah1 UTSW 14 31303907 missense probably benign 0.02
R1102:Dnah1 UTSW 14 31296457 nonsense probably null
R1116:Dnah1 UTSW 14 31307867 missense probably benign 0.13
R1229:Dnah1 UTSW 14 31310851 missense probably benign 0.11
R1447:Dnah1 UTSW 14 31306898 missense probably benign 0.06
R1449:Dnah1 UTSW 14 31263951 missense probably damaging 1.00
R1462:Dnah1 UTSW 14 31268781 splice site probably benign
R1482:Dnah1 UTSW 14 31294874 missense probably damaging 1.00
R1500:Dnah1 UTSW 14 31316758 missense probably benign
R1512:Dnah1 UTSW 14 31293037 missense probably damaging 1.00
R1591:Dnah1 UTSW 14 31272332 missense probably benign 0.01
R1598:Dnah1 UTSW 14 31301262 missense probably benign 0.07
R1644:Dnah1 UTSW 14 31302292 splice site probably benign
R1672:Dnah1 UTSW 14 31276200 missense probably damaging 1.00
R1713:Dnah1 UTSW 14 31279182 missense probably damaging 1.00
R1769:Dnah1 UTSW 14 31310882 missense probably null 0.05
R1796:Dnah1 UTSW 14 31261093 missense probably benign 0.00
R1902:Dnah1 UTSW 14 31319759 missense probably damaging 0.99
R1903:Dnah1 UTSW 14 31319759 missense probably damaging 0.99
R1905:Dnah1 UTSW 14 31264630 missense probably benign 0.06
R1908:Dnah1 UTSW 14 31262558 missense probably damaging 1.00
R1972:Dnah1 UTSW 14 31265391 nonsense probably null
R1973:Dnah1 UTSW 14 31265391 nonsense probably null
R2004:Dnah1 UTSW 14 31301856 missense possibly damaging 0.79
R2051:Dnah1 UTSW 14 31279123 missense probably damaging 1.00
R2062:Dnah1 UTSW 14 31271129 missense probably damaging 1.00
R2188:Dnah1 UTSW 14 31279164 missense probably damaging 0.98
R2240:Dnah1 UTSW 14 31299974 missense probably benign 0.00
R2862:Dnah1 UTSW 14 31284762 missense probably benign 0.21
R2894:Dnah1 UTSW 14 31298761 missense possibly damaging 0.67
R3120:Dnah1 UTSW 14 31266822 nonsense probably null
R3410:Dnah1 UTSW 14 31269817 missense possibly damaging 0.55
R3411:Dnah1 UTSW 14 31269817 missense possibly damaging 0.55
R3435:Dnah1 UTSW 14 31316674 missense probably damaging 0.96
R3615:Dnah1 UTSW 14 31315148 missense possibly damaging 0.92
R3616:Dnah1 UTSW 14 31315148 missense possibly damaging 0.92
R3741:Dnah1 UTSW 14 31265467 splice site probably benign
R3805:Dnah1 UTSW 14 31294763 missense possibly damaging 0.67
R3894:Dnah1 UTSW 14 31307028 missense probably benign
R4007:Dnah1 UTSW 14 31303784 splice site probably benign
R4201:Dnah1 UTSW 14 31262270 missense probably benign 0.00
R4232:Dnah1 UTSW 14 31304916 missense probably benign
R4372:Dnah1 UTSW 14 31304922 missense probably damaging 1.00
R4391:Dnah1 UTSW 14 31294835 missense probably damaging 1.00
R4423:Dnah1 UTSW 14 31284761 missense probably benign 0.00
R4526:Dnah1 UTSW 14 31285998 missense probably benign 0.05
R4650:Dnah1 UTSW 14 31284887 splice site probably null
R4723:Dnah1 UTSW 14 31272942 missense probably damaging 1.00
R4748:Dnah1 UTSW 14 31319945 missense probably benign
R4783:Dnah1 UTSW 14 31263479 missense probably damaging 1.00
R4784:Dnah1 UTSW 14 31263479 missense probably damaging 1.00
R4785:Dnah1 UTSW 14 31263479 missense probably damaging 1.00
R4843:Dnah1 UTSW 14 31264963 missense probably damaging 1.00
R4879:Dnah1 UTSW 14 31300748 missense possibly damaging 0.91
R4897:Dnah1 UTSW 14 31267539 missense probably damaging 1.00
R4911:Dnah1 UTSW 14 31295323 missense probably damaging 1.00
R4985:Dnah1 UTSW 14 31286898 missense probably null 1.00
R5070:Dnah1 UTSW 14 31282418 missense probably benign 0.05
R5128:Dnah1 UTSW 14 31296195 splice site probably null
R5409:Dnah1 UTSW 14 31263255 missense probably damaging 1.00
R5436:Dnah1 UTSW 14 31316747 missense probably benign
R5481:Dnah1 UTSW 14 31308871 missense possibly damaging 0.55
R5550:Dnah1 UTSW 14 31316708 missense probably benign 0.00
R5555:Dnah1 UTSW 14 31290819 missense probably damaging 0.99
R5566:Dnah1 UTSW 14 31274366 missense probably benign 0.35
R5623:Dnah1 UTSW 14 31286023 missense possibly damaging 0.62
R5701:Dnah1 UTSW 14 31274044 missense probably damaging 1.00
R5751:Dnah1 UTSW 14 31310906 missense probably benign 0.00
R5823:Dnah1 UTSW 14 31266418 missense possibly damaging 0.92
R6030:Dnah1 UTSW 14 31268027 missense probably damaging 1.00
R6030:Dnah1 UTSW 14 31268027 missense probably damaging 1.00
R6090:Dnah1 UTSW 14 31269425 missense possibly damaging 0.83
R6139:Dnah1 UTSW 14 31286027 missense probably benign 0.02
R6145:Dnah1 UTSW 14 31300970 missense probably benign 0.07
R6306:Dnah1 UTSW 14 31304587 missense probably damaging 0.97
R6376:Dnah1 UTSW 14 31275608 missense probably damaging 1.00
R6451:Dnah1 UTSW 14 31300808 missense probably benign 0.08
R6549:Dnah1 UTSW 14 31269383 missense probably damaging 1.00
R6748:Dnah1 UTSW 14 31299988 missense probably damaging 0.99
R6826:Dnah1 UTSW 14 31286290 missense probably benign 0.00
R6870:Dnah1 UTSW 14 31271061 nonsense probably null
R6932:Dnah1 UTSW 14 31287776 missense probably damaging 1.00
R7033:Dnah1 UTSW 14 31264925 missense probably damaging 1.00
R7078:Dnah1 UTSW 14 31297110 missense probably damaging 1.00
R7133:Dnah1 UTSW 14 31286076 missense probably benign
R7136:Dnah1 UTSW 14 31298656 missense probably damaging 1.00
Z1088:Dnah1 UTSW 14 31304811 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- ATCCAGAGGAGGTAGCCATG -3'
(R):5'- GAAGACATTGCAGGCATGAC -3'

Sequencing Primer
(F):5'- CCAGAGGAGGTAGCCATGGAAAC -3'
(R):5'- CTCATTTCATAGTCAAGGGTCCGAG -3'
Posted On2018-11-28