Incidental Mutation 'R6945:Cacnb4'
ID540824
Institutional Source Beutler Lab
Gene Symbol Cacnb4
Ensembl Gene ENSMUSG00000017412
Gene Namecalcium channel, voltage-dependent, beta 4 subunit
SynonymsCchb4, 3110038O15Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.240) question?
Stock #R6945 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location52428320-52676831 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 52474954 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 99 (N99S)
Ref Sequence ENSEMBL: ENSMUSP00000136811 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078324] [ENSMUST00000102760] [ENSMUST00000102761] [ENSMUST00000178799]
Predicted Effect probably damaging
Transcript: ENSMUST00000078324
AA Change: N99S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000077438
Gene: ENSMUSG00000017412
AA Change: N99S

DomainStartEndE-ValueType
Pfam:VGCC_beta4Aa_N 49 90 5.4e-27 PFAM
SH3 94 159 4.96e-2 SMART
low complexity region 172 189 N/A INTRINSIC
low complexity region 193 206 N/A INTRINSIC
GuKc 217 398 3.46e-37 SMART
low complexity region 465 481 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102760
AA Change: N66S

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000099821
Gene: ENSMUSG00000017412
AA Change: N66S

DomainStartEndE-ValueType
Pfam:VGCC_beta4Aa_N 16 57 9.4e-28 PFAM
SH3 61 126 4.96e-2 SMART
low complexity region 139 156 N/A INTRINSIC
low complexity region 160 173 N/A INTRINSIC
GuKc 184 365 3.46e-37 SMART
low complexity region 432 448 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102761
AA Change: N53S

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000099822
Gene: ENSMUSG00000017412
AA Change: N53S

DomainStartEndE-ValueType
Pfam:VGCC_beta4Aa_N 3 44 4.8e-27 PFAM
SH3 48 113 4.96e-2 SMART
low complexity region 126 143 N/A INTRINSIC
low complexity region 147 160 N/A INTRINSIC
GuKc 171 352 3.46e-37 SMART
low complexity region 419 435 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000178799
AA Change: N99S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000136811
Gene: ENSMUSG00000017412
AA Change: N99S

DomainStartEndE-ValueType
Pfam:VGCC_beta4Aa_N 49 90 1.3e-24 PFAM
SH3 94 159 4.96e-2 SMART
low complexity region 172 189 N/A INTRINSIC
GuKc 217 398 3.46e-37 SMART
low complexity region 465 481 N/A INTRINSIC
Meta Mutation Damage Score 0.47 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.5%
Validation Efficiency 96% (51/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the beta subunit family of voltage-dependent calcium channel complex proteins. Calcium channels mediate the influx of calcium ions into the cell upon membrane polarization and consist of a complex of alpha-1, alpha-2/delta, beta, and gamma subunits in a 1:1:1:1 ratio. Various versions of each of these subunits exist, either expressed from similar genes or the result of alternative splicing. The protein encoded by this locus plays an important role in calcium channel function by modulating G protein inhibition, increasing peak calcium current, controlling the alpha-1 subunit membrane targeting and shifting the voltage dependence of activation and inactivation. Certain mutations in this gene have been associated with idiopathic generalized epilepsy (IGE), juvenile myoclonic epilepsy (JME), and episodic ataxia, type 5. [provided by RefSeq, Aug 2016]
PHENOTYPE: Homozygous mutants have lethargic behavior, unstable gait and seizures, with peripheral motor nerves showing reduced conduction velocity and prolonged distal latency. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430403G16Rik A C 5: 109,676,845 N246K probably benign Het
AA792892 C T 5: 94,383,631 H125Y possibly damaging Het
Abcc5 T A 16: 20,400,009 T208S probably benign Het
Acaa2 A G 18: 74,793,309 E112G probably benign Het
Adgrb1 A G 15: 74,550,024 N881S probably damaging Het
Adgre1 A G 17: 57,410,844 E314G probably benign Het
Adgre1 A G 17: 57,420,399 E443G probably benign Het
Akp3 A G 1: 87,125,631 Y102C probably damaging Het
Birc6 A G 17: 74,579,531 N618S probably benign Het
Bpifc A G 10: 85,979,214 V296A probably benign Het
Cacna2d3 G A 14: 28,969,318 probably benign Het
Cd38 A G 5: 43,908,006 Y283C probably damaging Het
Celf4 T A 18: 25,496,236 Q411L probably damaging Het
Cemip A T 7: 83,998,547 H108Q probably damaging Het
Col23a1 A G 11: 51,561,893 E225G unknown Het
Dnah11 T C 12: 118,060,310 E1902G probably damaging Het
Dst A G 1: 34,190,490 D2063G probably damaging Het
Fsip2 A T 2: 82,992,840 I6306L probably benign Het
Furin A G 7: 80,391,090 S667P possibly damaging Het
Glmp T A 3: 88,325,832 S92R probably benign Het
Gm11563 C G 11: 99,658,472 C152S unknown Het
Gm3486 A G 14: 41,484,561 V185A probably benign Het
Gm4070 G A 7: 105,901,980 Q622* probably null Het
Hyal1 C A 9: 107,579,170 A102E probably damaging Het
Invs T C 4: 48,421,785 C806R probably benign Het
L1td1 T C 4: 98,733,696 V165A probably benign Het
Lama1 A G 17: 67,813,866 T2666A Het
Lrit1 G C 14: 37,060,095 V242L probably damaging Het
Lrrc8a A G 2: 30,256,227 Y351C probably damaging Het
Myh7b T C 2: 155,622,232 F551S possibly damaging Het
Myo19 A G 11: 84,897,560 T333A probably benign Het
Nrp2 A T 1: 62,760,788 N387I probably damaging Het
Oas2 T C 5: 120,736,139 D543G probably benign Het
Olfr1040 A G 2: 86,146,084 S217P probably damaging Het
Olfr117 A G 17: 37,659,514 I273T possibly damaging Het
Pak7 A G 2: 136,100,939 V427A probably benign Het
Pfas G A 11: 69,000,530 A247V probably benign Het
Psat1 T A 19: 15,917,181 T115S probably benign Het
Psme4 T A 11: 30,837,437 D1077E probably benign Het
Rabgap1l A G 1: 160,682,182 S442P probably benign Het
Ralgapa1 A G 12: 55,776,191 M280T possibly damaging Het
Rb1cc1 A T 1: 6,261,032 E394D probably damaging Het
Seh1l T C 18: 67,789,390 V271A probably benign Het
Sf3b1 A T 1: 54,997,156 N919K probably benign Het
Sftpd A G 14: 41,174,492 S245P possibly damaging Het
Slc22a15 T C 3: 101,924,114 E2G probably damaging Het
Spta1 A G 1: 174,209,325 D1134G possibly damaging Het
Syna A G 5: 134,558,961 V378A probably damaging Het
Tchp A G 5: 114,709,350 K77E possibly damaging Het
Tescl T C 7: 24,333,531 N123S probably benign Het
Trio C T 15: 27,824,090 R1443Q probably damaging Het
Trrap A T 5: 144,790,855 Y462F possibly damaging Het
Vmn1r78 A G 7: 12,152,905 T148A probably benign Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Other mutations in Cacnb4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00961:Cacnb4 APN 2 52477712 missense possibly damaging 0.46
IGL01328:Cacnb4 APN 2 52464625 missense probably damaging 1.00
IGL01801:Cacnb4 APN 2 52434711 missense probably benign 0.15
IGL01992:Cacnb4 APN 2 52465670 missense probably damaging 1.00
IGL03030:Cacnb4 APN 2 52474882 missense probably damaging 1.00
R0789:Cacnb4 UTSW 2 52451883 missense probably damaging 1.00
R1069:Cacnb4 UTSW 2 52455611 missense probably damaging 1.00
R1646:Cacnb4 UTSW 2 52474900 missense possibly damaging 0.87
R2050:Cacnb4 UTSW 2 52469586 missense probably damaging 0.99
R3939:Cacnb4 UTSW 2 52469489 missense probably damaging 1.00
R3941:Cacnb4 UTSW 2 52469489 missense probably damaging 1.00
R4455:Cacnb4 UTSW 2 52465653 missense probably damaging 1.00
R4497:Cacnb4 UTSW 2 52477771 missense probably damaging 1.00
R4707:Cacnb4 UTSW 2 52474915 missense probably benign 0.45
R4824:Cacnb4 UTSW 2 52675810 missense probably benign 0.00
R4957:Cacnb4 UTSW 2 52558291 missense probably damaging 0.99
R5913:Cacnb4 UTSW 2 52434784 intron probably benign
R6372:Cacnb4 UTSW 2 52434667 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTAACCGAGGCTCCACACTG -3'
(R):5'- TGTGGCCTGCAACTATAAAACC -3'

Sequencing Primer
(F):5'- ACACTGGCAGCTCTCTGG -3'
(R):5'- TATAAAACCCAGAGGAGAGCTCTC -3'
Posted On2018-11-28